Incidental Mutation 'R5905:Taf5l'
ID456525
Institutional Source Beutler Lab
Gene Symbol Taf5l
Ensembl Gene ENSMUSG00000038697
Gene NameTATA-box binding protein associated factor 5 like
Synonyms
MMRRC Submission 044102-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R5905 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location123996318-124021397 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 124002975 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093039] [ENSMUST00000127664] [ENSMUST00000165628] [ENSMUST00000212010]
Predicted Effect probably null
Transcript: ENSMUST00000093039
SMART Domains Protein: ENSMUSP00000090726
Gene: ENSMUSG00000038697

DomainStartEndE-ValueType
Pfam:TFIID_NTD2 61 195 8.4e-35 PFAM
WD40 257 296 6.66e-1 SMART
WD40 331 370 3.19e-7 SMART
WD40 373 412 5.95e-7 SMART
WD40 415 454 2.2e-10 SMART
WD40 457 496 1.2e-11 SMART
WD40 499 538 5.3e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000165628
SMART Domains Protein: ENSMUSP00000128710
Gene: ENSMUSG00000038697

DomainStartEndE-ValueType
Pfam:TFIID_90kDa 55 196 1.2e-43 PFAM
WD40 257 296 6.66e-1 SMART
WD40 331 370 3.19e-7 SMART
WD40 373 412 5.95e-7 SMART
WD40 415 454 2.2e-10 SMART
WD40 457 496 1.2e-11 SMART
WD40 499 538 5.3e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211825
Predicted Effect probably benign
Transcript: ENSMUST00000212010
Meta Mutation Damage Score 0.9753 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the WD-repeat TAF5 family of proteins. This gene encodes a protein that is a component of the PCAF histone acetylase complex. The PCAF histone acetylase complex, which is composed of more than 20 polypeptides some of which are TAFs, is required for myogenic transcription and differentiation. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors to facilitate complex assembly and transcription initiation. The encoded protein is structurally similar to one of the histone-like TAFs, TAF5. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T A 3: 36,479,569 probably null Het
Acat1 A T 9: 53,592,066 Y158N probably damaging Het
Adamtsl1 C A 4: 86,342,324 A924E probably damaging Het
Alad G T 4: 62,510,122 T305K probably benign Het
Als2cl G T 9: 110,898,084 R906L probably damaging Het
Ap3d1 T C 10: 80,722,927 N281S possibly damaging Het
Arf4 A G 14: 26,653,924 T113A probably benign Het
Arhgap8 A T 15: 84,741,977 K84N possibly damaging Het
Asah2 T C 19: 32,016,514 D438G probably damaging Het
Cachd1 C A 4: 100,983,556 N905K probably damaging Het
Catsperb T A 12: 101,602,700 M877K possibly damaging Het
Cc2d2a A T 5: 43,712,426 M890L probably benign Het
Cd180 A T 13: 102,706,033 H529L possibly damaging Het
Cdh23 G T 10: 60,534,535 D160E probably damaging Het
Chd7 C A 4: 8,840,553 N1440K possibly damaging Het
Cntln T A 4: 84,971,173 S298T probably benign Het
Dmap1 G T 4: 117,676,766 T132K probably benign Het
Dnah11 C T 12: 117,954,924 G3424E probably damaging Het
Dnah5 T A 15: 28,387,833 M3146K probably damaging Het
Egfr A T 11: 16,911,494 E1091V probably damaging Het
Eps8l2 T C 7: 141,357,833 F422S possibly damaging Het
F2r A G 13: 95,604,613 V138A possibly damaging Het
Faf1 T A 4: 109,890,929 M477K probably benign Het
Fam149b C T 14: 20,359,910 T235M probably benign Het
Fan1 C A 7: 64,353,651 A808S probably benign Het
Fbxl20 A G 11: 98,115,445 I38T probably damaging Het
Fnbp4 C A 2: 90,751,134 T177K probably benign Het
Gm884 A T 11: 103,614,255 S2296T probably damaging Het
Gm9747 T C 1: 82,234,298 probably benign Het
Grip1 A G 10: 119,985,492 D354G probably benign Het
Grk4 A C 5: 34,711,730 Y189S probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hgfac A G 5: 35,042,362 N63D probably benign Het
Hk1 C A 10: 62,353,058 K25N probably null Het
Hrc G A 7: 45,336,234 G270S probably damaging Het
Inhba T A 13: 16,017,308 W5R probably benign Het
Lipm T C 19: 34,111,911 S90P probably benign Het
Lman1l A G 9: 57,608,263 I443T probably damaging Het
Lmod3 T A 6: 97,247,614 E415D probably damaging Het
Lrrc63 A G 14: 75,086,174 S537P possibly damaging Het
Map9 T A 3: 82,380,248 probably null Het
Marf1 T A 16: 14,127,249 Q1252L probably damaging Het
Mc3r A T 2: 172,249,209 D117V probably damaging Het
Mepce A G 5: 137,784,720 V448A possibly damaging Het
Mical1 A T 10: 41,486,877 M973L probably benign Het
Mmp21 T C 7: 133,678,714 T176A probably benign Het
Nacc2 A G 2: 26,061,578 V415A probably damaging Het
Neb G A 2: 52,193,231 T1639I probably damaging Het
Nfia A G 4: 98,111,251 H485R possibly damaging Het
Nlrp9a C T 7: 26,558,337 T460I probably benign Het
Olfr1079 T A 2: 86,538,769 I49F possibly damaging Het
Olfr12 T A 1: 92,620,142 C79S possibly damaging Het
Olfr625-ps1 T A 7: 103,683,574 N285K probably damaging Het
Olfr689 T C 7: 105,314,951 Y316H probably benign Het
Olfr763 A T 10: 129,011,287 M1L probably benign Het
Olfr938 T A 9: 39,078,083 I221F probably damaging Het
Otoa T A 7: 121,094,601 L68Q probably damaging Het
Pclo A T 5: 14,680,385 probably benign Het
Pcsk2 T A 2: 143,749,140 Y186N probably damaging Het
Pigz A G 16: 31,945,428 T435A probably benign Het
Pja2 T C 17: 64,309,090 D270G probably benign Het
Polb G T 8: 22,639,995 S187* probably null Het
Popdc3 A G 10: 45,317,919 D272G probably benign Het
Prss36 T C 7: 127,933,572 D716G probably benign Het
Rapgef5 T A 12: 117,748,426 D547E probably damaging Het
Slc4a11 T A 2: 130,685,052 I719F probably damaging Het
Smpd2 A G 10: 41,489,348 W51R probably damaging Het
Snrpb T A 2: 130,179,276 probably benign Het
Sox9 A G 11: 112,783,820 E148G probably damaging Het
Strbp G A 2: 37,625,255 T253I probably damaging Het
Sult1d1 A T 5: 87,559,826 M145K probably damaging Het
Syt17 T C 7: 118,436,918 D74G probably benign Het
Tas2r131 T G 6: 132,957,676 I57L probably benign Het
Tcf25 A G 8: 123,381,437 N77S possibly damaging Het
Tmem253 A G 14: 52,017,811 T57A possibly damaging Het
Trrap A G 5: 144,849,920 K3170R possibly damaging Het
Tspan17 A G 13: 54,793,298 N130S probably damaging Het
Vmn1r216 C T 13: 23,099,197 L17F probably damaging Het
Vmn2r3 T A 3: 64,275,277 T334S probably benign Het
Wnk2 G T 13: 49,076,345 A901E probably damaging Het
Zc3hav1 T C 6: 38,307,340 T947A probably benign Het
Zfhx3 C T 8: 108,793,503 P419L probably damaging Het
Zfp292 A G 4: 34,819,549 S258P probably damaging Het
Zfp354c T C 11: 50,815,426 Y274C probably damaging Het
Zfp652 G A 11: 95,749,863 A205T probably benign Het
Zfp964 A G 8: 69,663,913 T388A unknown Het
Other mutations in Taf5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02850:Taf5l APN 8 124003458 missense possibly damaging 0.94
IGL03371:Taf5l APN 8 123997986 missense possibly damaging 0.52
Invalid UTSW 8 124002975 critical splice donor site probably null
R0017:Taf5l UTSW 8 124003644 missense probably damaging 1.00
R1708:Taf5l UTSW 8 124009770 nonsense probably null
R1813:Taf5l UTSW 8 124003413 missense probably damaging 1.00
R1861:Taf5l UTSW 8 123997990 missense probably damaging 1.00
R1896:Taf5l UTSW 8 124003413 missense probably damaging 1.00
R4570:Taf5l UTSW 8 123997550 missense probably damaging 1.00
R4656:Taf5l UTSW 8 123998105 missense probably benign
R5294:Taf5l UTSW 8 124008218 missense probably benign 0.11
R5335:Taf5l UTSW 8 124003651 missense probably damaging 1.00
R5480:Taf5l UTSW 8 124009820 missense possibly damaging 0.78
R6028:Taf5l UTSW 8 124002975 critical splice donor site probably null
R7105:Taf5l UTSW 8 124003212 missense probably damaging 1.00
R8304:Taf5l UTSW 8 124003512 missense probably benign 0.03
R8337:Taf5l UTSW 8 123998102 missense probably benign 0.00
X0024:Taf5l UTSW 8 123998021 missense probably benign 0.04
Z1088:Taf5l UTSW 8 123997338 nonsense probably null
Z1176:Taf5l UTSW 8 123997362 missense probably benign 0.06
Z1177:Taf5l UTSW 8 124002999 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAAGCTCTGTTAGTCAGGC -3'
(R):5'- TAACACGGAACAGCTGCTG -3'

Sequencing Primer
(F):5'- TGCTTTCCAGACAGTGACAC -3'
(R):5'- TGCTGAATACTGCAGAGATCTCC -3'
Posted On2017-02-15