Incidental Mutation 'R5905:Or8g24'
ID 456526
Institutional Source Beutler Lab
Gene Symbol Or8g24
Ensembl Gene ENSMUSG00000048501
Gene Name olfactory receptor family 8 subfamily G member 24
Synonyms MOR171-25, Olfr938, GA_x6K02T2PVTD-32774646-32773699
MMRRC Submission 044102-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R5905 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 38989092-38990039 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 38989379 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 221 (I221F)
Ref Sequence ENSEMBL: ENSMUSP00000055053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056499]
AlphaFold Q9EQ93
Predicted Effect probably damaging
Transcript: ENSMUST00000056499
AA Change: I221F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055053
Gene: ENSMUSG00000048501
AA Change: I221F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8e-49 PFAM
Pfam:7tm_1 41 290 5.5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175411
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215888
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T A 3: 36,533,718 (GRCm39) probably null Het
Acat1 A T 9: 53,503,366 (GRCm39) Y158N probably damaging Het
Adamtsl1 C A 4: 86,260,561 (GRCm39) A924E probably damaging Het
Alad G T 4: 62,428,359 (GRCm39) T305K probably benign Het
Als2cl G T 9: 110,727,152 (GRCm39) R906L probably damaging Het
Ap3d1 T C 10: 80,558,761 (GRCm39) N281S possibly damaging Het
Arf4 A G 14: 26,375,079 (GRCm39) T113A probably benign Het
Asah2 T C 19: 31,993,914 (GRCm39) D438G probably damaging Het
Cachd1 C A 4: 100,840,753 (GRCm39) N905K probably damaging Het
Catsperb T A 12: 101,568,959 (GRCm39) M877K possibly damaging Het
Cc2d2a A T 5: 43,869,768 (GRCm39) M890L probably benign Het
Cd180 A T 13: 102,842,541 (GRCm39) H529L possibly damaging Het
Cdh23 G T 10: 60,370,314 (GRCm39) D160E probably damaging Het
Chd7 C A 4: 8,840,553 (GRCm39) N1440K possibly damaging Het
Cntln T A 4: 84,889,410 (GRCm39) S298T probably benign Het
Cplx3 A G 9: 57,515,546 (GRCm39) I443T probably damaging Het
Dmap1 G T 4: 117,533,963 (GRCm39) T132K probably benign Het
Dnah11 C T 12: 117,918,659 (GRCm39) G3424E probably damaging Het
Dnah5 T A 15: 28,387,979 (GRCm39) M3146K probably damaging Het
Egfr A T 11: 16,861,494 (GRCm39) E1091V probably damaging Het
Eps8l2 T C 7: 140,937,746 (GRCm39) F422S possibly damaging Het
F2r A G 13: 95,741,121 (GRCm39) V138A possibly damaging Het
Faf1 T A 4: 109,748,126 (GRCm39) M477K probably benign Het
Fam149b C T 14: 20,409,978 (GRCm39) T235M probably benign Het
Fan1 C A 7: 64,003,399 (GRCm39) A808S probably benign Het
Fbxl20 A G 11: 98,006,271 (GRCm39) I38T probably damaging Het
Fnbp4 C A 2: 90,581,478 (GRCm39) T177K probably benign Het
Gm9747 T C 1: 82,212,019 (GRCm39) probably benign Het
Grip1 A G 10: 119,821,397 (GRCm39) D354G probably benign Het
Grk4 A C 5: 34,869,074 (GRCm39) Y189S probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,905,247 (GRCm39) probably benign Het
Hgfac A G 5: 35,199,706 (GRCm39) N63D probably benign Het
Hk1 C A 10: 62,188,837 (GRCm39) K25N probably null Het
Hrc G A 7: 44,985,658 (GRCm39) G270S probably damaging Het
Inhba T A 13: 16,191,893 (GRCm39) W5R probably benign Het
Lipm T C 19: 34,089,311 (GRCm39) S90P probably benign Het
Lmod3 T A 6: 97,224,575 (GRCm39) E415D probably damaging Het
Lrrc37 A T 11: 103,505,081 (GRCm39) S2296T probably damaging Het
Lrrc63 A G 14: 75,323,614 (GRCm39) S537P possibly damaging Het
Map9 T A 3: 82,287,555 (GRCm39) probably null Het
Marf1 T A 16: 13,945,113 (GRCm39) Q1252L probably damaging Het
Mc3r A T 2: 172,091,129 (GRCm39) D117V probably damaging Het
Mepce A G 5: 137,782,982 (GRCm39) V448A possibly damaging Het
Mical1 A T 10: 41,362,873 (GRCm39) M973L probably benign Het
Mmp21 T C 7: 133,280,443 (GRCm39) T176A probably benign Het
Nacc2 A G 2: 25,951,590 (GRCm39) V415A probably damaging Het
Neb G A 2: 52,083,243 (GRCm39) T1639I probably damaging Het
Nfia A G 4: 97,999,488 (GRCm39) H485R possibly damaging Het
Nlrp9a C T 7: 26,257,762 (GRCm39) T460I probably benign Het
Or10p21 A T 10: 128,847,156 (GRCm39) M1L probably benign Het
Or52z15 T A 7: 103,332,781 (GRCm39) N285K probably damaging Het
Or56b35 T C 7: 104,964,158 (GRCm39) Y316H probably benign Het
Or8k32 T A 2: 86,369,113 (GRCm39) I49F possibly damaging Het
Or9s13 T A 1: 92,547,864 (GRCm39) C79S possibly damaging Het
Otoa T A 7: 120,693,824 (GRCm39) L68Q probably damaging Het
Pclo A T 5: 14,730,399 (GRCm39) probably benign Het
Pcsk2 T A 2: 143,591,060 (GRCm39) Y186N probably damaging Het
Pigz A G 16: 31,764,246 (GRCm39) T435A probably benign Het
Pja2 T C 17: 64,616,085 (GRCm39) D270G probably benign Het
Polb G T 8: 23,130,011 (GRCm39) S187* probably null Het
Popdc3 A G 10: 45,194,015 (GRCm39) D272G probably benign Het
Prr5 A T 15: 84,626,178 (GRCm39) K84N possibly damaging Het
Prss36 T C 7: 127,532,744 (GRCm39) D716G probably benign Het
Rapgef5 T A 12: 117,712,161 (GRCm39) D547E probably damaging Het
Slc4a11 T A 2: 130,526,972 (GRCm39) I719F probably damaging Het
Smpd2 A G 10: 41,365,344 (GRCm39) W51R probably damaging Het
Snrpb T A 2: 130,021,196 (GRCm39) probably benign Het
Sox9 A G 11: 112,674,646 (GRCm39) E148G probably damaging Het
Strbp G A 2: 37,515,267 (GRCm39) T253I probably damaging Het
Sult1d1 A T 5: 87,707,685 (GRCm39) M145K probably damaging Het
Syt17 T C 7: 118,036,141 (GRCm39) D74G probably benign Het
Taf5l A C 8: 124,729,714 (GRCm39) probably null Het
Tas2r131 T G 6: 132,934,639 (GRCm39) I57L probably benign Het
Tcf25 A G 8: 124,108,176 (GRCm39) N77S possibly damaging Het
Tmem253 A G 14: 52,255,268 (GRCm39) T57A possibly damaging Het
Trrap A G 5: 144,786,730 (GRCm39) K3170R possibly damaging Het
Tspan17 A G 13: 54,941,111 (GRCm39) N130S probably damaging Het
Vmn1r216 C T 13: 23,283,367 (GRCm39) L17F probably damaging Het
Vmn2r3 T A 3: 64,182,698 (GRCm39) T334S probably benign Het
Wnk2 G T 13: 49,229,821 (GRCm39) A901E probably damaging Het
Zc3hav1 T C 6: 38,284,275 (GRCm39) T947A probably benign Het
Zfhx3 C T 8: 109,520,135 (GRCm39) P419L probably damaging Het
Zfp292 A G 4: 34,819,549 (GRCm39) S258P probably damaging Het
Zfp354c T C 11: 50,706,253 (GRCm39) Y274C probably damaging Het
Zfp652 G A 11: 95,640,689 (GRCm39) A205T probably benign Het
Zfp964 A G 8: 70,116,563 (GRCm39) T388A unknown Het
Other mutations in Or8g24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Or8g24 APN 9 38,989,747 (GRCm39) missense probably damaging 0.96
IGL01298:Or8g24 APN 9 38,990,020 (GRCm39) missense possibly damaging 0.63
IGL02930:Or8g24 APN 9 38,989,308 (GRCm39) missense probably damaging 1.00
IGL03346:Or8g24 APN 9 38,989,257 (GRCm39) missense probably benign 0.35
IGL03346:Or8g24 APN 9 38,989,258 (GRCm39) missense probably damaging 0.99
IGL03399:Or8g24 APN 9 38,989,533 (GRCm39) nonsense probably null
R0536:Or8g24 UTSW 9 38,989,625 (GRCm39) missense probably benign 0.03
R1170:Or8g24 UTSW 9 38,989,525 (GRCm39) missense possibly damaging 0.50
R1951:Or8g24 UTSW 9 38,989,580 (GRCm39) missense probably benign 0.07
R1952:Or8g24 UTSW 9 38,989,580 (GRCm39) missense probably benign 0.07
R2066:Or8g24 UTSW 9 38,989,510 (GRCm39) missense probably damaging 1.00
R2906:Or8g24 UTSW 9 38,989,669 (GRCm39) missense probably benign 0.39
R4707:Or8g24 UTSW 9 38,989,558 (GRCm39) missense probably benign 0.00
R4767:Or8g24 UTSW 9 38,989,988 (GRCm39) missense possibly damaging 0.71
R4951:Or8g24 UTSW 9 38,989,555 (GRCm39) missense probably benign 0.10
R5888:Or8g24 UTSW 9 38,989,263 (GRCm39) nonsense probably null
R6028:Or8g24 UTSW 9 38,989,379 (GRCm39) missense probably damaging 1.00
R6329:Or8g24 UTSW 9 38,989,199 (GRCm39) missense probably benign 0.02
R7240:Or8g24 UTSW 9 38,989,906 (GRCm39) missense probably damaging 0.99
R7345:Or8g24 UTSW 9 38,989,630 (GRCm39) missense probably damaging 1.00
R8058:Or8g24 UTSW 9 38,989,862 (GRCm39) missense probably damaging 1.00
R9023:Or8g24 UTSW 9 38,989,307 (GRCm39) missense probably benign 0.09
R9547:Or8g24 UTSW 9 38,989,927 (GRCm39) missense probably damaging 0.99
R9682:Or8g24 UTSW 9 38,989,874 (GRCm39) missense possibly damaging 0.95
R9760:Or8g24 UTSW 9 38,989,271 (GRCm39) missense possibly damaging 0.95
X0062:Or8g24 UTSW 9 38,989,762 (GRCm39) missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- GGATTCAACATAGGCACAACAATG -3'
(R):5'- GCTTAATCAGTGCCACAGCTC -3'

Sequencing Primer
(F):5'- GGCACAACAATGGTATAAAACACTG -3'
(R):5'- GCTCACACAGTCTTCCTACTAAGAG -3'
Posted On 2017-02-15