Incidental Mutation 'R5905:Als2cl'
ID456529
Institutional Source Beutler Lab
Gene Symbol Als2cl
Ensembl Gene ENSMUSG00000044037
Gene NameALS2 C-terminal like
SynonymsmRn.49018, D930044G19Rik
MMRRC Submission 044102-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R5905 (G1)
Quality Score144
Status Not validated
Chromosome9
Chromosomal Location110879870-110900530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 110898084 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 906 (R906L)
Ref Sequence ENSEMBL: ENSMUSP00000115718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084926] [ENSMUST00000130386] [ENSMUST00000155014]
Predicted Effect probably damaging
Transcript: ENSMUST00000084926
AA Change: R906L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081989
Gene: ENSMUSG00000044037
AA Change: R906L

DomainStartEndE-ValueType
SCOP:d1by1a_ 8 215 2e-3 SMART
Blast:PH 220 318 8e-7 BLAST
MORN 356 377 1.83e-3 SMART
Pfam:MORN 381 397 4.5e-4 PFAM
MORN 407 428 1.2e1 SMART
MORN 430 451 3.71e-1 SMART
MORN 457 478 4.33e-1 SMART
MORN 481 502 3.18e-1 SMART
MORN 504 525 1.68e0 SMART
MORN 527 549 3.63e1 SMART
Pfam:VPS9 833 937 1.3e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130386
AA Change: R906L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123304
Gene: ENSMUSG00000044037
AA Change: R906L

DomainStartEndE-ValueType
SCOP:d1by1a_ 8 215 2e-3 SMART
Blast:PH 220 318 8e-7 BLAST
MORN 356 377 1.83e-3 SMART
Pfam:MORN 381 397 4.5e-4 PFAM
MORN 407 428 1.2e1 SMART
MORN 430 451 3.71e-1 SMART
MORN 457 478 4.33e-1 SMART
MORN 481 502 3.18e-1 SMART
MORN 504 525 1.68e0 SMART
MORN 527 549 3.63e1 SMART
Pfam:VPS9 833 937 1.3e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155014
AA Change: R906L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115718
Gene: ENSMUSG00000044037
AA Change: R906L

DomainStartEndE-ValueType
SCOP:d1by1a_ 8 215 2e-3 SMART
Blast:PH 220 318 8e-7 BLAST
MORN 356 377 1.83e-3 SMART
Pfam:MORN 381 399 5.6e-4 PFAM
MORN 407 428 1.2e1 SMART
MORN 430 451 3.71e-1 SMART
MORN 457 478 4.33e-1 SMART
MORN 481 502 3.18e-1 SMART
MORN 504 525 1.68e0 SMART
MORN 527 549 3.63e1 SMART
Pfam:VPS9 833 937 1.7e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195890
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T A 3: 36,479,569 probably null Het
Acat1 A T 9: 53,592,066 Y158N probably damaging Het
Adamtsl1 C A 4: 86,342,324 A924E probably damaging Het
Alad G T 4: 62,510,122 T305K probably benign Het
Ap3d1 T C 10: 80,722,927 N281S possibly damaging Het
Arf4 A G 14: 26,653,924 T113A probably benign Het
Arhgap8 A T 15: 84,741,977 K84N possibly damaging Het
Asah2 T C 19: 32,016,514 D438G probably damaging Het
Cachd1 C A 4: 100,983,556 N905K probably damaging Het
Catsperb T A 12: 101,602,700 M877K possibly damaging Het
Cc2d2a A T 5: 43,712,426 M890L probably benign Het
Cd180 A T 13: 102,706,033 H529L possibly damaging Het
Cdh23 G T 10: 60,534,535 D160E probably damaging Het
Chd7 C A 4: 8,840,553 N1440K possibly damaging Het
Cntln T A 4: 84,971,173 S298T probably benign Het
Dmap1 G T 4: 117,676,766 T132K probably benign Het
Dnah11 C T 12: 117,954,924 G3424E probably damaging Het
Dnah5 T A 15: 28,387,833 M3146K probably damaging Het
Egfr A T 11: 16,911,494 E1091V probably damaging Het
Eps8l2 T C 7: 141,357,833 F422S possibly damaging Het
F2r A G 13: 95,604,613 V138A possibly damaging Het
Faf1 T A 4: 109,890,929 M477K probably benign Het
Fam149b C T 14: 20,359,910 T235M probably benign Het
Fan1 C A 7: 64,353,651 A808S probably benign Het
Fbxl20 A G 11: 98,115,445 I38T probably damaging Het
Fnbp4 C A 2: 90,751,134 T177K probably benign Het
Gm884 A T 11: 103,614,255 S2296T probably damaging Het
Gm9747 T C 1: 82,234,298 probably benign Het
Grip1 A G 10: 119,985,492 D354G probably benign Het
Grk4 A C 5: 34,711,730 Y189S probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hgfac A G 5: 35,042,362 N63D probably benign Het
Hk1 C A 10: 62,353,058 K25N probably null Het
Hrc G A 7: 45,336,234 G270S probably damaging Het
Inhba T A 13: 16,017,308 W5R probably benign Het
Lipm T C 19: 34,111,911 S90P probably benign Het
Lman1l A G 9: 57,608,263 I443T probably damaging Het
Lmod3 T A 6: 97,247,614 E415D probably damaging Het
Lrrc63 A G 14: 75,086,174 S537P possibly damaging Het
Map9 T A 3: 82,380,248 probably null Het
Marf1 T A 16: 14,127,249 Q1252L probably damaging Het
Mc3r A T 2: 172,249,209 D117V probably damaging Het
Mepce A G 5: 137,784,720 V448A possibly damaging Het
Mical1 A T 10: 41,486,877 M973L probably benign Het
Mmp21 T C 7: 133,678,714 T176A probably benign Het
Nacc2 A G 2: 26,061,578 V415A probably damaging Het
Neb G A 2: 52,193,231 T1639I probably damaging Het
Nfia A G 4: 98,111,251 H485R possibly damaging Het
Nlrp9a C T 7: 26,558,337 T460I probably benign Het
Olfr1079 T A 2: 86,538,769 I49F possibly damaging Het
Olfr12 T A 1: 92,620,142 C79S possibly damaging Het
Olfr625-ps1 T A 7: 103,683,574 N285K probably damaging Het
Olfr689 T C 7: 105,314,951 Y316H probably benign Het
Olfr763 A T 10: 129,011,287 M1L probably benign Het
Olfr938 T A 9: 39,078,083 I221F probably damaging Het
Otoa T A 7: 121,094,601 L68Q probably damaging Het
Pclo A T 5: 14,680,385 probably benign Het
Pcsk2 T A 2: 143,749,140 Y186N probably damaging Het
Pigz A G 16: 31,945,428 T435A probably benign Het
Pja2 T C 17: 64,309,090 D270G probably benign Het
Polb G T 8: 22,639,995 S187* probably null Het
Popdc3 A G 10: 45,317,919 D272G probably benign Het
Prss36 T C 7: 127,933,572 D716G probably benign Het
Rapgef5 T A 12: 117,748,426 D547E probably damaging Het
Slc4a11 T A 2: 130,685,052 I719F probably damaging Het
Smpd2 A G 10: 41,489,348 W51R probably damaging Het
Snrpb T A 2: 130,179,276 probably benign Het
Sox9 A G 11: 112,783,820 E148G probably damaging Het
Strbp G A 2: 37,625,255 T253I probably damaging Het
Sult1d1 A T 5: 87,559,826 M145K probably damaging Het
Syt17 T C 7: 118,436,918 D74G probably benign Het
Taf5l A C 8: 124,002,975 probably null Het
Tas2r131 T G 6: 132,957,676 I57L probably benign Het
Tcf25 A G 8: 123,381,437 N77S possibly damaging Het
Tmem253 A G 14: 52,017,811 T57A possibly damaging Het
Trrap A G 5: 144,849,920 K3170R possibly damaging Het
Tspan17 A G 13: 54,793,298 N130S probably damaging Het
Vmn1r216 C T 13: 23,099,197 L17F probably damaging Het
Vmn2r3 T A 3: 64,275,277 T334S probably benign Het
Wnk2 G T 13: 49,076,345 A901E probably damaging Het
Zc3hav1 T C 6: 38,307,340 T947A probably benign Het
Zfhx3 C T 8: 108,793,503 P419L probably damaging Het
Zfp292 A G 4: 34,819,549 S258P probably damaging Het
Zfp354c T C 11: 50,815,426 Y274C probably damaging Het
Zfp652 G A 11: 95,749,863 A205T probably benign Het
Zfp964 A G 8: 69,663,913 T388A unknown Het
Other mutations in Als2cl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Als2cl APN 9 110886539 critical splice donor site probably null
IGL00743:Als2cl APN 9 110889159 missense possibly damaging 0.88
IGL01504:Als2cl APN 9 110889283 missense probably benign 0.05
IGL01991:Als2cl APN 9 110892917 missense probably benign 0.00
IGL02073:Als2cl APN 9 110894339 missense probably benign
IGL02407:Als2cl APN 9 110889227 nonsense probably null
IGL03266:Als2cl APN 9 110890856 missense possibly damaging 0.74
R0006:Als2cl UTSW 9 110894618 missense possibly damaging 0.93
R0127:Als2cl UTSW 9 110891867 missense probably damaging 1.00
R0395:Als2cl UTSW 9 110898084 missense probably damaging 1.00
R0490:Als2cl UTSW 9 110895346 missense probably benign 0.04
R0540:Als2cl UTSW 9 110895784 nonsense probably null
R0900:Als2cl UTSW 9 110890428 missense possibly damaging 0.94
R1542:Als2cl UTSW 9 110894034 missense probably benign 0.36
R1574:Als2cl UTSW 9 110884060 missense probably damaging 1.00
R1574:Als2cl UTSW 9 110884060 missense probably damaging 1.00
R2059:Als2cl UTSW 9 110885438 missense probably benign 0.00
R2168:Als2cl UTSW 9 110888742 missense probably damaging 1.00
R2851:Als2cl UTSW 9 110894135 missense probably damaging 0.99
R2853:Als2cl UTSW 9 110894135 missense probably damaging 0.99
R2919:Als2cl UTSW 9 110897499 critical splice acceptor site probably null
R3761:Als2cl UTSW 9 110898134 missense probably damaging 1.00
R3848:Als2cl UTSW 9 110889309 splice site probably benign
R3850:Als2cl UTSW 9 110889309 splice site probably benign
R4110:Als2cl UTSW 9 110884047 missense probably benign 0.18
R4438:Als2cl UTSW 9 110885398 missense probably damaging 0.98
R4732:Als2cl UTSW 9 110889136 missense probably damaging 0.99
R4733:Als2cl UTSW 9 110889136 missense probably damaging 0.99
R5060:Als2cl UTSW 9 110884137 missense probably damaging 0.99
R5119:Als2cl UTSW 9 110890819 missense probably damaging 1.00
R5913:Als2cl UTSW 9 110889705 critical splice acceptor site probably null
R5930:Als2cl UTSW 9 110887364 missense probably damaging 1.00
R6197:Als2cl UTSW 9 110895884 missense probably damaging 1.00
R6362:Als2cl UTSW 9 110895446 splice site probably null
R7052:Als2cl UTSW 9 110898083 missense probably damaging 1.00
R7081:Als2cl UTSW 9 110894582 missense possibly damaging 0.66
R7472:Als2cl UTSW 9 110898106 missense probably benign 0.05
R7854:Als2cl UTSW 9 110898496 makesense probably null
R8120:Als2cl UTSW 9 110885392 missense possibly damaging 0.57
R8279:Als2cl UTSW 9 110894585 missense probably damaging 1.00
R8458:Als2cl UTSW 9 110884957 missense probably damaging 0.98
X0011:Als2cl UTSW 9 110885011 missense probably damaging 1.00
Z1177:Als2cl UTSW 9 110888528 missense probably benign 0.00
Z1177:Als2cl UTSW 9 110895817 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGAAGCCCAGAAAGGAGCC -3'
(R):5'- TTAGGAACAGCTGTCAGCC -3'

Sequencing Primer
(F):5'- AGCCAGTCTCATGAGATCTGG -3'
(R):5'- GAACAGCTGTCAGCCATGTTCTG -3'
Posted On2017-02-15