Mutagenetix > Incidental Mutations

Incidental Mutation 'R0557:Dip2c'

45666

Institutional Source

Beutler Lab

Gene Symbol

Dip2c

Ensembl Gene

ENSMUSG00000048264

Gene Name

disco interacting protein 2 homolog C

Synonyms

2900024P20Rik

MMRRC Submission

038749-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.375) question?

Stock #

R0557 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

9276528-9668928 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 9553459 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 405 (I405F)

Ref Sequence

ENSEMBL: ENSMUSP00000131238 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552]

Predicted Effect

probably benign
Transcript: ENSMUST00000166299
AA Change: I349F

PolyPhen 2 Score 0.402 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264
AA Change: I349F

Domain	Start	End	E-Value	Type
DMAP_binding	7	120	3.55e-43	SMART
low complexity region	170	187	N/A	INTRINSIC
low complexity region	275	287	N/A	INTRINSIC
Pfam:AMP-binding	324	801	3.6e-23	PFAM
Pfam:AMP-binding	977	1451	1.5e-72	PFAM
low complexity region	1514	1526	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169960
AA Change: I405F

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264
AA Change: I405F

Domain	Start	End	E-Value	Type
DMAP_binding	7	176	3.02e-37	SMART
low complexity region	226	243	N/A	INTRINSIC
low complexity region	331	343	N/A	INTRINSIC
Pfam:AMP-binding	380	637	5.9e-10	PFAM
SCOP:d1lci__	675	875	2e-8	SMART
Pfam:AMP-binding	947	1421	1.2e-56	PFAM
low complexity region	1484	1496	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174552
AA Change: I349F

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264
AA Change: I349F

Domain	Start	End	E-Value	Type
DMAP_binding	7	120	3.55e-43	SMART
low complexity region	170	187	N/A	INTRINSIC
low complexity region	275	287	N/A	INTRINSIC
Pfam:AMP-binding	324	800	2.7e-20	PFAM
Pfam:AMP-binding	976	1450	1.3e-56	PFAM
low complexity region	1513	1525	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221729

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	G	A	10: 79,067,685	H266Y	probably damaging	Het
Abi3bp	C	T	16: 56,668,387	R1294C	probably damaging	Het
Acot3	T	C	12: 84,058,856	Y366H	probably damaging	Het
Ago1	A	G	4: 126,460,024	V254A	probably benign	Het
Ahnak	T	A	19: 9,001,944	D197E	probably benign	Het
Aldh1b1	A	T	4: 45,802,647	T62S	probably benign	Het
Alox12e	T	C	11: 70,321,448	R135G	possibly damaging	Het
Amn1	T	C	6: 149,171,005	Y78C	possibly damaging	Het
Ankmy2	G	A	12: 36,187,766	S288N	probably benign	Het
Ano3	A	T	2: 110,862,952		probably null	Het
Arfgap3	T	C	15: 83,303,185	D491G	probably damaging	Het
Arhgap15	T	C	2: 44,116,617	S249P	possibly damaging	Het
Atp9b	A	G	18: 80,765,922	V211A	probably damaging	Het
Cabin1	A	G	10: 75,726,917	Y12H	probably damaging	Het
Cdkn2aip	T	C	8: 47,712,942	T110A	probably damaging	Het
Chchd6	A	G	6: 89,574,587	S31P	probably damaging	Het
Chrna3	A	G	9: 55,015,865	Y220H	probably damaging	Het
Ctu1	A	G	7: 43,677,159	D414G	unknown	Het
Cxxc1	C	T	18: 74,218,774	R241W	possibly damaging	Het
Cyp3a16	A	G	5: 145,469,588	I18T	unknown	Het
Disp3	A	T	4: 148,241,404	M1299K	possibly damaging	Het
Dnah9	T	G	11: 66,084,666	H1519P	probably damaging	Het
Ehd3	C	A	17: 73,829,933	Q366K	probably benign	Het
Exosc3	A	T	4: 45,316,957	M232K	probably damaging	Het
Fam196a	A	G	7: 134,918,705	L32P	probably damaging	Het
Fancm	T	C	12: 65,118,442		probably null	Het
Fgfr2	A	G	7: 130,219,081	V241A	probably damaging	Het
Gdf2	C	T	14: 33,941,221	P24L	probably damaging	Het
Hars2	T	C	18: 36,791,077	I489T	possibly damaging	Het
Ice1	T	C	13: 70,601,191	I1945V	probably benign	Het
Il33	A	C	19: 29,954,636	N143T	probably damaging	Het
Ilvbl	G	A	10: 78,583,487	W313*	probably null	Het
Isca1	G	T	13: 59,756,974	Q91K	possibly damaging	Het
Kcnh5	T	A	12: 75,114,549	Y195F	probably damaging	Het
Lama4	T	G	10: 39,088,397	I1355S	probably benign	Het
Lonrf1	T	C	8: 36,230,420	D470G	probably benign	Het
Mak	A	G	13: 41,039,659	Y446H	probably benign	Het
Mki67	C	T	7: 135,699,261	S1348N	possibly damaging	Het
Mpzl3	A	G	9: 45,066,508	Y138C	probably damaging	Het
Myh8	T	C	11: 67,301,798	L1501P	possibly damaging	Het
Naa35	A	G	13: 59,627,964	E552G	probably damaging	Het
Ncor2	A	T	5: 125,106,305	L200*	probably null	Het
Nrm	T	C	17: 35,864,632	V210A	probably damaging	Het
Nt5e	T	A	9: 88,366,466	N405K	probably damaging	Het
Olfr108	T	A	17: 37,445,821	I100N	probably damaging	Het
Olfr350	T	A	2: 36,850,748	I234N	possibly damaging	Het
Orc2	T	C	1: 58,469,687	S434G	probably damaging	Het
Plcb4	G	A	2: 135,954,349	V388I	probably damaging	Het
Ppm1l	A	G	3: 69,497,901	D177G	probably benign	Het
Prl8a2	A	T	13: 27,352,892	R165*	probably null	Het
Ptbp3	G	A	4: 59,517,684	R66*	probably null	Het
Pten	A	G	19: 32,817,890	T286A	probably benign	Het
Rac2	C	T	15: 78,564,974	V113M	probably damaging	Het
Rai1	C	T	11: 60,190,495	T1795I	probably benign	Het
Ros1	T	G	10: 52,085,263	K1792Q	possibly damaging	Het
Sema6a	A	G	18: 47,249,500	V660A	probably benign	Het
Slc22a23	C	T	13: 34,344,383	G139S	possibly damaging	Het
Slc26a5	A	G	5: 21,819,764	S441P	probably damaging	Het
Slc27a3	A	G	3: 90,386,856	L462P	probably damaging	Het
Spag5	T	A	11: 78,314,211	S607R	probably damaging	Het
Spata18	A	T	5: 73,651,670	N29Y	probably damaging	Het
Spata20	C	T	11: 94,485,222	R22H	probably benign	Het
Spsb2	A	C	6: 124,810,392	Y263S	probably damaging	Het
Sptbn4	C	A	7: 27,408,328	E885*	probably null	Het
Syne2	T	C	12: 75,929,301	I1175T	probably benign	Het
Tmem2	C	T	19: 21,811,903	A567V	probably benign	Het
Tmem209	A	C	6: 30,501,914	H253Q	probably damaging	Het
Trip12	A	T	1: 84,724,747	D788E	probably damaging	Het
Usp34	T	C	11: 23,403,848	S1509P	probably damaging	Het
Utp20	A	T	10: 88,748,311	D2661E	probably damaging	Het
Vars	C	A	17: 35,004,984	P264Q	possibly damaging	Het
Vmn2r66	T	G	7: 84,994,764	S813R	probably damaging	Het
Wipf2	C	A	11: 98,892,089	Q114K	possibly damaging	Het
Wnt5b	G	T	6: 119,433,818	H220Q	probably damaging	Het
Xirp2	A	G	2: 67,516,351	T2979A	probably benign	Het
Zfyve9	A	G	4: 108,674,511	V408A	probably damaging	Het
Zzef1	T	C	11: 72,917,730	S2744P	probably damaging	Het

Other mutations in Dip2c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Dip2c	APN	13	9493108	missense	probably damaging	0.97
IGL00426:Dip2c	APN	13	9606515	missense	probably damaging	1.00
IGL00503:Dip2c	APN	13	9567898	missense	probably damaging	1.00
IGL00586:Dip2c	APN	13	9610755	missense	probably damaging	1.00
IGL01306:Dip2c	APN	13	9575143	missense	possibly damaging	0.72
IGL01580:Dip2c	APN	13	9637088	splice site	probably null
IGL01985:Dip2c	APN	13	9553267	splice site	probably benign
IGL02060:Dip2c	APN	13	9622630	missense	probably damaging	0.98
IGL02122:Dip2c	APN	13	9506659	missense	possibly damaging	0.48
IGL02170:Dip2c	APN	13	9606335	missense	probably benign	0.03
IGL02211:Dip2c	APN	13	9610847	missense	probably damaging	1.00
IGL02755:Dip2c	APN	13	9550320	critical splice donor site	probably null
IGL02836:Dip2c	APN	13	9610790	missense	probably damaging	0.98
IGL02935:Dip2c	APN	13	9662146	missense	probably damaging	1.00
IGL03032:Dip2c	APN	13	9551778	missense	probably damaging	1.00
ANU23:Dip2c	UTSW	13	9575143	missense	possibly damaging	0.72
P0038:Dip2c	UTSW	13	9646982	missense	probably damaging	1.00
R0009:Dip2c	UTSW	13	9621903	missense	probably damaging	1.00
R0268:Dip2c	UTSW	13	9637150	missense	probably damaging	1.00
R0271:Dip2c	UTSW	13	9615775	missense	probably damaging	1.00
R0306:Dip2c	UTSW	13	9604599	missense	probably benign	0.09
R0415:Dip2c	UTSW	13	9568289	splice site	probably benign
R0519:Dip2c	UTSW	13	9563208	missense	probably damaging	1.00
R0964:Dip2c	UTSW	13	9568663	missense	probably benign	0.43
R0973:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R0973:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R0974:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R1101:Dip2c	UTSW	13	9634744	missense	probably damaging	1.00
R1171:Dip2c	UTSW	13	9493126	missense	possibly damaging	0.89
R1403:Dip2c	UTSW	13	9553264	splice site	probably null
R1403:Dip2c	UTSW	13	9553264	splice site	probably null
R1432:Dip2c	UTSW	13	9553304	missense	probably damaging	0.99
R1481:Dip2c	UTSW	13	9551866	critical splice donor site	probably null
R1588:Dip2c	UTSW	13	9665864	missense	probably damaging	1.00
R1721:Dip2c	UTSW	13	9659368	missense	probably damaging	1.00
R1726:Dip2c	UTSW	13	9575428	missense	probably damaging	1.00
R1867:Dip2c	UTSW	13	9621949	missense	possibly damaging	0.55
R1909:Dip2c	UTSW	13	9533350	missense	probably benign	0.00
R2013:Dip2c	UTSW	13	9567846	nonsense	probably null
R2022:Dip2c	UTSW	13	9551800	missense	probably damaging	1.00
R2517:Dip2c	UTSW	13	9609005	missense	probably damaging	1.00
R3746:Dip2c	UTSW	13	9601473	missense	probably damaging	1.00
R3794:Dip2c	UTSW	13	9604561	missense	probably damaging	0.99
R3884:Dip2c	UTSW	13	9551858	missense	probably damaging	1.00
R4019:Dip2c	UTSW	13	9614365	missense	probably damaging	0.99
R4110:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4111:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4113:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4256:Dip2c	UTSW	13	9609056	missense	probably damaging	1.00
R4300:Dip2c	UTSW	13	9610711	missense	probably damaging	1.00
R4494:Dip2c	UTSW	13	9571062	missense	possibly damaging	0.64
R4739:Dip2c	UTSW	13	9533339	missense	probably damaging	0.98
R4812:Dip2c	UTSW	13	9637130	nonsense	probably null
R4814:Dip2c	UTSW	13	9536860	missense	probably benign	0.07
R4816:Dip2c	UTSW	13	9575150	missense	probably benign	0.37
R4828:Dip2c	UTSW	13	9560679	missense	probably damaging	1.00
R4915:Dip2c	UTSW	13	9621869	splice site	probably null
R4917:Dip2c	UTSW	13	9621869	splice site	probably null
R4932:Dip2c	UTSW	13	9623972	missense	probably damaging	0.99
R4993:Dip2c	UTSW	13	9575223	nonsense	probably null
R5043:Dip2c	UTSW	13	9551827	missense	possibly damaging	0.80
R5349:Dip2c	UTSW	13	9622653	missense	probably damaging	1.00
R5744:Dip2c	UTSW	13	9568405	missense	probably damaging	1.00
R5840:Dip2c	UTSW	13	9506676	missense	possibly damaging	0.68
R6110:Dip2c	UTSW	13	9623766	missense	probably damaging	1.00
R6160:Dip2c	UTSW	13	9533254	missense	probably benign	0.01
R6161:Dip2c	UTSW	13	9647007	missense	probably damaging	1.00
R6477:Dip2c	UTSW	13	9623760	missense	probably damaging	1.00
R6522:Dip2c	UTSW	13	9575228	critical splice donor site	probably null
R6603:Dip2c	UTSW	13	9654588	splice site	probably null
R6658:Dip2c	UTSW	13	9493177	critical splice donor site	probably null
R6672:Dip2c	UTSW	13	9567830	critical splice acceptor site	probably null
R6697:Dip2c	UTSW	13	9621913	missense	probably damaging	1.00
R6991:Dip2c	UTSW	13	9551860	nonsense	probably null
R6991:Dip2c	UTSW	13	9634832	missense	probably damaging	1.00
R7018:Dip2c	UTSW	13	9659278	missense	probably damaging	1.00
R7053:Dip2c	UTSW	13	9610704	missense	probably damaging	1.00
R7102:Dip2c	UTSW	13	9604536	missense	probably benign	0.01
R7171:Dip2c	UTSW	13	9506648	missense	probably benign	0.34
R7371:Dip2c	UTSW	13	9592749	missense	probably benign	0.02
R7395:Dip2c	UTSW	13	9614377	missense	probably damaging	1.00
R7489:Dip2c	UTSW	13	9533312	missense	probably damaging	0.99
R7575:Dip2c	UTSW	13	9628012	missense	probably damaging	0.97
R7642:Dip2c	UTSW	13	9622705	critical splice donor site	probably null
R7687:Dip2c	UTSW	13	9604581	missense	probably benign	0.00
R7699:Dip2c	UTSW	13	9659311	missense	probably benign	0.00
R7700:Dip2c	UTSW	13	9659311	missense	probably benign	0.00
R7715:Dip2c	UTSW	13	9614391	missense	probably damaging	1.00
R7842:Dip2c	UTSW	13	9606533	critical splice donor site	probably null
R7845:Dip2c	UTSW	13	9609044	missense	probably damaging	1.00
R7925:Dip2c	UTSW	13	9606533	critical splice donor site	probably null
R7928:Dip2c	UTSW	13	9609044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAAAGCATCTTCGCCATCAGCC -3'
(R):5'- AGATCAAGTGACATAGAGTTACAATCACAGC -3'

Sequencing Primer
(F):5'- GCCATCAGCCTTAAGTATCAATCTC -3'
(R):5'- GCCACCCAGAAGATGTGTATTGT -3'

Posted On

2013-06-11