Incidental Mutation 'R0557:Slc22a23'
ID 45668
Institutional Source Beutler Lab
Gene Symbol Slc22a23
Ensembl Gene ENSMUSG00000038267
Gene Name solute carrier family 22, member 23
Synonyms 3110004L20Rik
MMRRC Submission 038749-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.160) question?
Stock # R0557 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 34179158-34345182 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 34344383 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 139 (G139S)
Ref Sequence ENSEMBL: ENSMUSP00000042742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040336]
AlphaFold Q3UHH2
Predicted Effect possibly damaging
Transcript: ENSMUST00000040336
AA Change: G139S

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000042742
Gene: ENSMUSG00000038267
AA Change: G139S

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
Pfam:Sugar_tr 187 633 5e-26 PFAM
Pfam:MFS_1 224 518 2.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143353
Predicted Effect unknown
Transcript: ENSMUST00000145038
AA Change: G71S
SMART Domains Protein: ENSMUSP00000122376
Gene: ENSMUSG00000038267
AA Change: G71S

DomainStartEndE-ValueType
low complexity region 86 97 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000148390
AA Change: G23S
SMART Domains Protein: ENSMUSP00000122283
Gene: ENSMUSG00000038267
AA Change: G23S

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
Pfam:Sugar_tr 71 510 1.4e-27 PFAM
Pfam:MFS_1 109 402 1.5e-12 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC22A23 belongs to a large family of transmembrane proteins that function as uniporters, symporters, and antiporters to transport organic ions across cell membranes (Jacobsson et al., 2007 [PubMed 17714910]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 79,067,685 H266Y probably damaging Het
Abi3bp C T 16: 56,668,387 R1294C probably damaging Het
Acot3 T C 12: 84,058,856 Y366H probably damaging Het
Ago1 A G 4: 126,460,024 V254A probably benign Het
Ahnak T A 19: 9,001,944 D197E probably benign Het
Aldh1b1 A T 4: 45,802,647 T62S probably benign Het
Alox12e T C 11: 70,321,448 R135G possibly damaging Het
Amn1 T C 6: 149,171,005 Y78C possibly damaging Het
Ankmy2 G A 12: 36,187,766 S288N probably benign Het
Ano3 A T 2: 110,862,952 probably null Het
Arfgap3 T C 15: 83,303,185 D491G probably damaging Het
Arhgap15 T C 2: 44,116,617 S249P possibly damaging Het
Atp9b A G 18: 80,765,922 V211A probably damaging Het
Cabin1 A G 10: 75,726,917 Y12H probably damaging Het
Cdkn2aip T C 8: 47,712,942 T110A probably damaging Het
Chchd6 A G 6: 89,574,587 S31P probably damaging Het
Chrna3 A G 9: 55,015,865 Y220H probably damaging Het
Ctu1 A G 7: 43,677,159 D414G unknown Het
Cxxc1 C T 18: 74,218,774 R241W possibly damaging Het
Cyp3a16 A G 5: 145,469,588 I18T unknown Het
Dip2c A T 13: 9,553,459 I405F possibly damaging Het
Disp3 A T 4: 148,241,404 M1299K possibly damaging Het
Dnah9 T G 11: 66,084,666 H1519P probably damaging Het
Ehd3 C A 17: 73,829,933 Q366K probably benign Het
Exosc3 A T 4: 45,316,957 M232K probably damaging Het
Fam196a A G 7: 134,918,705 L32P probably damaging Het
Fancm T C 12: 65,118,442 probably null Het
Fgfr2 A G 7: 130,219,081 V241A probably damaging Het
Gdf2 C T 14: 33,941,221 P24L probably damaging Het
Hars2 T C 18: 36,791,077 I489T possibly damaging Het
Ice1 T C 13: 70,601,191 I1945V probably benign Het
Il33 A C 19: 29,954,636 N143T probably damaging Het
Ilvbl G A 10: 78,583,487 W313* probably null Het
Isca1 G T 13: 59,756,974 Q91K possibly damaging Het
Kcnh5 T A 12: 75,114,549 Y195F probably damaging Het
Lama4 T G 10: 39,088,397 I1355S probably benign Het
Lonrf1 T C 8: 36,230,420 D470G probably benign Het
Mak A G 13: 41,039,659 Y446H probably benign Het
Mki67 C T 7: 135,699,261 S1348N possibly damaging Het
Mpzl3 A G 9: 45,066,508 Y138C probably damaging Het
Myh8 T C 11: 67,301,798 L1501P possibly damaging Het
Naa35 A G 13: 59,627,964 E552G probably damaging Het
Ncor2 A T 5: 125,106,305 L200* probably null Het
Nrm T C 17: 35,864,632 V210A probably damaging Het
Nt5e T A 9: 88,366,466 N405K probably damaging Het
Olfr108 T A 17: 37,445,821 I100N probably damaging Het
Olfr350 T A 2: 36,850,748 I234N possibly damaging Het
Orc2 T C 1: 58,469,687 S434G probably damaging Het
Plcb4 G A 2: 135,954,349 V388I probably damaging Het
Ppm1l A G 3: 69,497,901 D177G probably benign Het
Prl8a2 A T 13: 27,352,892 R165* probably null Het
Ptbp3 G A 4: 59,517,684 R66* probably null Het
Pten A G 19: 32,817,890 T286A probably benign Het
Rac2 C T 15: 78,564,974 V113M probably damaging Het
Rai1 C T 11: 60,190,495 T1795I probably benign Het
Ros1 T G 10: 52,085,263 K1792Q possibly damaging Het
Sema6a A G 18: 47,249,500 V660A probably benign Het
Slc26a5 A G 5: 21,819,764 S441P probably damaging Het
Slc27a3 A G 3: 90,386,856 L462P probably damaging Het
Spag5 T A 11: 78,314,211 S607R probably damaging Het
Spata18 A T 5: 73,651,670 N29Y probably damaging Het
Spata20 C T 11: 94,485,222 R22H probably benign Het
Spsb2 A C 6: 124,810,392 Y263S probably damaging Het
Sptbn4 C A 7: 27,408,328 E885* probably null Het
Syne2 T C 12: 75,929,301 I1175T probably benign Het
Tmem2 C T 19: 21,811,903 A567V probably benign Het
Tmem209 A C 6: 30,501,914 H253Q probably damaging Het
Trip12 A T 1: 84,724,747 D788E probably damaging Het
Usp34 T C 11: 23,403,848 S1509P probably damaging Het
Utp20 A T 10: 88,748,311 D2661E probably damaging Het
Vars C A 17: 35,004,984 P264Q possibly damaging Het
Vmn2r66 T G 7: 84,994,764 S813R probably damaging Het
Wipf2 C A 11: 98,892,089 Q114K possibly damaging Het
Wnt5b G T 6: 119,433,818 H220Q probably damaging Het
Xirp2 A G 2: 67,516,351 T2979A probably benign Het
Zfyve9 A G 4: 108,674,511 V408A probably damaging Het
Zzef1 T C 11: 72,917,730 S2744P probably damaging Het
Other mutations in Slc22a23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Slc22a23 APN 13 34305245 missense probably damaging 1.00
IGL01762:Slc22a23 APN 13 34204001 missense possibly damaging 0.71
IGL02496:Slc22a23 APN 13 34344485 missense possibly damaging 0.93
IGL02516:Slc22a23 APN 13 34203955 missense probably benign 0.02
IGL02831:Slc22a23 APN 13 34299069 missense possibly damaging 0.81
Foreshadowed UTSW 13 34195479 missense probably damaging 0.98
foretold UTSW 13 34305180 missense probably benign 0.08
BB009:Slc22a23 UTSW 13 34182977 missense probably damaging 0.99
BB019:Slc22a23 UTSW 13 34182977 missense probably damaging 0.99
R0234:Slc22a23 UTSW 13 34183261 missense probably damaging 1.00
R0234:Slc22a23 UTSW 13 34183261 missense probably damaging 1.00
R0413:Slc22a23 UTSW 13 34183132 missense probably damaging 1.00
R0558:Slc22a23 UTSW 13 34344383 missense possibly damaging 0.50
R0636:Slc22a23 UTSW 13 34299093 missense probably benign 0.01
R0676:Slc22a23 UTSW 13 34195479 missense probably damaging 0.98
R0739:Slc22a23 UTSW 13 34344383 missense possibly damaging 0.50
R0990:Slc22a23 UTSW 13 34195467 missense probably damaging 1.00
R1515:Slc22a23 UTSW 13 34203964 missense probably benign 0.33
R2128:Slc22a23 UTSW 13 34203970 missense possibly damaging 0.76
R2147:Slc22a23 UTSW 13 34183007 missense probably benign 0.00
R3113:Slc22a23 UTSW 13 34183075 missense probably damaging 0.98
R3780:Slc22a23 UTSW 13 34344340 missense probably benign 0.14
R3945:Slc22a23 UTSW 13 34183126 missense probably damaging 0.98
R3946:Slc22a23 UTSW 13 34183126 missense probably damaging 0.98
R4056:Slc22a23 UTSW 13 34299004 nonsense probably null
R4095:Slc22a23 UTSW 13 34305206 missense probably damaging 1.00
R4854:Slc22a23 UTSW 13 34203941 missense probably benign
R5594:Slc22a23 UTSW 13 34305257 missense probably damaging 0.99
R5611:Slc22a23 UTSW 13 34305239 missense probably benign 0.00
R6167:Slc22a23 UTSW 13 34344559 missense probably damaging 0.97
R6927:Slc22a23 UTSW 13 34344379 missense probably benign 0.07
R6933:Slc22a23 UTSW 13 34305180 missense probably benign 0.08
R6960:Slc22a23 UTSW 13 34344157 critical splice donor site probably null
R7291:Slc22a23 UTSW 13 34197839 missense probably damaging 0.99
R7313:Slc22a23 UTSW 13 34183178 missense probably damaging 1.00
R7932:Slc22a23 UTSW 13 34182977 missense probably damaging 0.99
R8058:Slc22a23 UTSW 13 34305184 nonsense probably null
R9385:Slc22a23 UTSW 13 34344578 missense probably benign 0.05
R9560:Slc22a23 UTSW 13 34197868 missense possibly damaging 0.51
R9630:Slc22a23 UTSW 13 34195407 missense possibly damaging 0.93
X0064:Slc22a23 UTSW 13 34344466 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGATGAGACCAGTGCGGATGC -3'
(R):5'- AGCCTCCTGTTGCTGGACTACG -3'

Sequencing Primer
(F):5'- AGTGCGGATGCCGTAGTC -3'
(R):5'- TGCTGGACTACGATGGCTC -3'
Posted On 2013-06-11