Incidental Mutation 'R0558:Atic'
Institutional Source Beutler Lab
Gene Symbol Atic
Ensembl Gene ENSMUSG00000026192
Gene Name5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
MMRRC Submission 038750-MU
Accession Numbers

Genbank: NM_026195; MGI: 1351352

Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R0558 (G1)
Quality Score225
Status Validated
Chromosomal Location71557150-71579631 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71563788 bp
Amino Acid Change Valine to Glutamic Acid at position 107 (V107E)
Ref Sequence ENSEMBL: ENSMUSP00000027384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027384]
Predicted Effect probably benign
Transcript: ENSMUST00000027384
AA Change: V107E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027384
Gene: ENSMUSG00000026192
AA Change: V107E

MGS 16 130 1.31e-46 SMART
AICARFT_IMPCHas 135 462 4.84e-132 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155769
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187982
Meta Mutation Damage Score 0.0611 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bifunctional protein that catalyzes the last two steps of the de novo purine biosynthetic pathway. The N-terminal domain has phosphoribosylaminoimidazolecarboxamide formyltransferase activity, and the C-terminal domain has IMP cyclohydrolase activity. A mutation in this gene results in AICA-ribosiduria. [provided by RefSeq, Sep 2009]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik T C 17: 25,947,549 N338S probably benign Het
Abcc2 G A 19: 43,800,724 G273R probably benign Het
Adamts10 T C 17: 33,550,609 V935A probably benign Het
Anapc15-ps T C 10: 95,673,121 D90G probably damaging Het
Atp4b T C 8: 13,393,523 T52A possibly damaging Het
Cacna1h C T 17: 25,381,550 A1606T probably damaging Het
Cacng6 T A 7: 3,434,808 Y217* probably null Het
Cc2d2a T G 5: 43,724,387 probably benign Het
Cd226 T A 18: 89,207,214 H78Q probably benign Het
Cers3 A G 7: 66,783,418 D161G probably damaging Het
Ces1f T C 8: 93,275,389 H37R probably benign Het
Chek1 T A 9: 36,712,115 N421I possibly damaging Het
Cma2 T C 14: 55,972,792 Y45H probably damaging Het
Cmas C A 6: 142,775,244 Y401* probably null Het
Cyp2j8 A T 4: 96,444,634 S492T probably benign Het
Dnah12 T C 14: 26,709,310 S358P probably benign Het
Dnajc13 T C 9: 104,201,952 probably null Het
Ep400 A C 5: 110,685,067 probably benign Het
Fam209 T A 2: 172,472,838 N82K probably benign Het
Fam92a T C 4: 12,164,095 D248G probably damaging Het
G3bp2 A T 5: 92,073,197 Y20N probably damaging Het
Gli2 T C 1: 118,837,649 D924G probably benign Het
Gm10787 T C 10: 77,022,016 noncoding transcript Het
Gm11568 A G 11: 99,858,046 R26G unknown Het
Gm4788 A G 1: 139,739,492 V376A probably damaging Het
Hivep3 T G 4: 120,096,566 L693R probably damaging Het
Hook1 A G 4: 95,993,212 probably benign Het
Ibtk A C 9: 85,737,538 D116E probably damaging Het
Insrr C T 3: 87,810,981 T927I possibly damaging Het
Irx1 T G 13: 71,959,628 S312R probably benign Het
Itga11 T C 9: 62,752,288 Y441H probably benign Het
Itsn1 A G 16: 91,899,623 D38G possibly damaging Het
Kat6b G T 14: 21,669,421 E1280D probably benign Het
Kcnk10 T A 12: 98,436,301 Y293F possibly damaging Het
Krt74 T A 15: 101,760,963 noncoding transcript Het
Lars T G 18: 42,214,837 I974L probably benign Het
Limch1 A G 5: 66,969,155 D42G probably damaging Het
Mau2 G C 8: 70,042,432 T85R probably damaging Het
Mkrn3 A G 7: 62,418,864 I393T probably benign Het
Mpl A C 4: 118,444,020 S541R probably damaging Het
Nfrkb T C 9: 31,410,268 S754P possibly damaging Het
Olfr1170 A G 2: 88,224,474 V186A possibly damaging Het
Olfr1233 A G 2: 89,340,236 L22P probably benign Het
Olfr1350 T C 7: 6,570,653 Y221H possibly damaging Het
Olfr1537 T A 9: 39,238,200 T75S probably damaging Het
P2rx7 A T 5: 122,673,798 I391F possibly damaging Het
Pbrm1 T A 14: 31,085,059 probably null Het
Pcdh8 T C 14: 79,770,076 D349G probably damaging Het
Pias1 A G 9: 62,882,009 S639P possibly damaging Het
Pkhd1l1 A T 15: 44,484,424 I232F probably damaging Het
Plxnc1 C T 10: 94,837,935 R995Q probably damaging Het
Pnliprp2 T A 19: 58,774,087 S375T probably benign Het
Prkar1b C T 5: 139,020,092 V313M probably benign Het
Ptpn13 T C 5: 103,529,717 S734P probably damaging Het
Rdh1 T C 10: 127,759,941 W2R possibly damaging Het
Rsph10b A T 5: 143,949,338 I285L probably benign Het
Rubcnl T C 14: 75,047,547 F502S probably damaging Het
Ryr2 T A 13: 11,638,443 I3693F probably damaging Het
Ryr2 T C 13: 11,799,861 Y675C probably damaging Het
Scaper T C 9: 55,685,923 T477A probably benign Het
Scn2a G T 2: 65,711,925 V791L probably benign Het
Sdk1 A T 5: 142,132,065 T1573S probably damaging Het
Sema3c A T 5: 17,714,415 H483L probably benign Het
Sema6c T C 3: 95,168,691 S219P probably damaging Het
Slc10a5 T G 3: 10,335,117 E161A probably damaging Het
Slc22a23 C T 13: 34,344,383 G139S possibly damaging Het
Slc34a3 C T 2: 25,233,065 probably benign Het
Slc38a9 A T 13: 112,729,196 probably null Het
Taok1 A C 11: 77,559,844 S367R possibly damaging Het
Tlr6 G A 5: 64,954,860 Q235* probably null Het
Top2a A G 11: 98,996,839 V1281A probably benign Het
Tpgs1 T C 10: 79,675,782 Y253H probably damaging Het
Tubgcp3 T C 8: 12,653,462 T288A probably benign Het
Ubr4 A G 4: 139,426,902 E2140G probably benign Het
Uso1 A G 5: 92,174,019 Q257R probably benign Het
Zfp106 A G 2: 120,532,196 V48A probably damaging Het
Zfp174 T A 16: 3,848,254 S128T possibly damaging Het
Zscan26 T A 13: 21,445,055 D426V probably benign Het
Other mutations in Atic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01947:Atic APN 1 71570837 splice site probably benign
IGL02368:Atic APN 1 71564565 splice site probably benign
IGL03291:Atic APN 1 71570922 missense probably benign 0.06
3-1:Atic UTSW 1 71560895 nonsense probably null
R0039:Atic UTSW 1 71577850 missense possibly damaging 0.95
R0039:Atic UTSW 1 71577850 missense possibly damaging 0.95
R1222:Atic UTSW 1 71559279 missense probably damaging 1.00
R1662:Atic UTSW 1 71576127 missense probably benign 0.06
R2075:Atic UTSW 1 71576127 missense probably benign 0.06
R2402:Atic UTSW 1 71569057 nonsense probably null
R2475:Atic UTSW 1 71559269 missense probably damaging 1.00
R2566:Atic UTSW 1 71568971 missense probably damaging 0.98
R3711:Atic UTSW 1 71578579 missense probably benign 0.02
R5115:Atic UTSW 1 71557275 critical splice donor site probably null
R5215:Atic UTSW 1 71564507 missense probably damaging 0.98
R5444:Atic UTSW 1 71576717 missense probably damaging 0.96
R6348:Atic UTSW 1 71576698 missense probably damaging 1.00
R6370:Atic UTSW 1 71578660 missense probably damaging 1.00
R6374:Atic UTSW 1 71564941 missense probably damaging 1.00
R6909:Atic UTSW 1 71576846 splice site probably null
R7224:Atic UTSW 1 71570855 missense probably benign
R7444:Atic UTSW 1 71563787 missense probably benign 0.05
R7724:Atic UTSW 1 71564901 missense probably damaging 1.00
R8171:Atic UTSW 1 71569873 missense possibly damaging 0.84
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gagactaaggcaggaggattac -3'
Posted On2013-06-11