Incidental Mutation 'R0558:Gm4788'
ID45693
Institutional Source Beutler Lab
Gene Symbol Gm4788
Ensembl Gene ENSMUSG00000070594
Gene Namepredicted gene 4788
Synonyms
MMRRC Submission 038750-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R0558 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location139697623-139781243 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139739492 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 376 (V376A)
Ref Sequence ENSEMBL: ENSMUSP00000027612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027612] [ENSMUST00000111986] [ENSMUST00000111989]
Predicted Effect probably damaging
Transcript: ENSMUST00000027612
AA Change: V376A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027612
Gene: ENSMUSG00000070594
AA Change: V376A

DomainStartEndE-ValueType
CCP 28 88 1.65e-2 SMART
CCP 92 145 1.15e-10 SMART
CCP 151 208 5.65e-10 SMART
CCP 212 267 1.12e-4 SMART
CCP 272 325 4.52e-9 SMART
CCP 332 386 9.1e-14 SMART
CCP 393 446 1.58e-13 SMART
CCP 455 505 4.92e-1 SMART
CCP 511 564 8.9e-8 SMART
CCP 569 622 4.18e-13 SMART
CCP 627 681 3.5e-15 SMART
CCP 688 742 5.69e-15 SMART
CCP 746 807 2.77e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111986
AA Change: V377A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107617
Gene: ENSMUSG00000070594
AA Change: V377A

DomainStartEndE-ValueType
CCP 28 88 1.65e-2 SMART
CCP 92 145 1.15e-10 SMART
CCP 151 208 5.65e-10 SMART
CCP 212 267 1.12e-4 SMART
CCP 272 325 4.52e-9 SMART
CCP 333 387 9.1e-14 SMART
CCP 394 447 1.58e-13 SMART
CCP 456 506 4.92e-1 SMART
CCP 512 565 8.9e-8 SMART
CCP 571 635 2.66e-6 SMART
CCP 640 693 4.18e-13 SMART
CCP 700 754 5.69e-15 SMART
CCP 758 819 2.77e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111989
AA Change: V377A

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107620
Gene: ENSMUSG00000070594
AA Change: V377A

DomainStartEndE-ValueType
CCP 28 88 1.65e-2 SMART
CCP 92 145 1.15e-10 SMART
CCP 151 208 5.65e-10 SMART
CCP 212 267 1.12e-4 SMART
CCP 272 325 4.52e-9 SMART
CCP 333 387 9.1e-14 SMART
CCP 394 447 1.58e-13 SMART
CCP 456 506 4.92e-1 SMART
CCP 512 565 8.9e-8 SMART
CCP 571 635 2.66e-6 SMART
CCP 640 693 4.18e-13 SMART
CCP 698 752 3.5e-15 SMART
CCP 759 813 5.69e-15 SMART
CCP 817 878 2.77e0 SMART
Meta Mutation Damage Score 0.1750 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (80/80)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik T C 17: 25,947,549 N338S probably benign Het
Abcc2 G A 19: 43,800,724 G273R probably benign Het
Adamts10 T C 17: 33,550,609 V935A probably benign Het
Anapc15-ps T C 10: 95,673,121 D90G probably damaging Het
Atic T A 1: 71,563,788 V107E probably benign Het
Atp4b T C 8: 13,393,523 T52A possibly damaging Het
Cacna1h C T 17: 25,381,550 A1606T probably damaging Het
Cacng6 T A 7: 3,434,808 Y217* probably null Het
Cc2d2a T G 5: 43,724,387 probably benign Het
Cd226 T A 18: 89,207,214 H78Q probably benign Het
Cers3 A G 7: 66,783,418 D161G probably damaging Het
Ces1f T C 8: 93,275,389 H37R probably benign Het
Chek1 T A 9: 36,712,115 N421I possibly damaging Het
Cma2 T C 14: 55,972,792 Y45H probably damaging Het
Cmas C A 6: 142,775,244 Y401* probably null Het
Cyp2j8 A T 4: 96,444,634 S492T probably benign Het
Dnah12 T C 14: 26,709,310 S358P probably benign Het
Dnajc13 T C 9: 104,201,952 probably null Het
Ep400 A C 5: 110,685,067 probably benign Het
Fam209 T A 2: 172,472,838 N82K probably benign Het
Fam92a T C 4: 12,164,095 D248G probably damaging Het
G3bp2 A T 5: 92,073,197 Y20N probably damaging Het
Gli2 T C 1: 118,837,649 D924G probably benign Het
Gm10787 T C 10: 77,022,016 noncoding transcript Het
Gm11568 A G 11: 99,858,046 R26G unknown Het
Hivep3 T G 4: 120,096,566 L693R probably damaging Het
Hook1 A G 4: 95,993,212 probably benign Het
Ibtk A C 9: 85,737,538 D116E probably damaging Het
Insrr C T 3: 87,810,981 T927I possibly damaging Het
Irx1 T G 13: 71,959,628 S312R probably benign Het
Itga11 T C 9: 62,752,288 Y441H probably benign Het
Itsn1 A G 16: 91,899,623 D38G possibly damaging Het
Kat6b G T 14: 21,669,421 E1280D probably benign Het
Kcnk10 T A 12: 98,436,301 Y293F possibly damaging Het
Krt74 T A 15: 101,760,963 noncoding transcript Het
Lars T G 18: 42,214,837 I974L probably benign Het
Limch1 A G 5: 66,969,155 D42G probably damaging Het
Mau2 G C 8: 70,042,432 T85R probably damaging Het
Mkrn3 A G 7: 62,418,864 I393T probably benign Het
Mpl A C 4: 118,444,020 S541R probably damaging Het
Nfrkb T C 9: 31,410,268 S754P possibly damaging Het
Olfr1170 A G 2: 88,224,474 V186A possibly damaging Het
Olfr1233 A G 2: 89,340,236 L22P probably benign Het
Olfr1350 T C 7: 6,570,653 Y221H possibly damaging Het
Olfr1537 T A 9: 39,238,200 T75S probably damaging Het
P2rx7 A T 5: 122,673,798 I391F possibly damaging Het
Pbrm1 T A 14: 31,085,059 probably null Het
Pcdh8 T C 14: 79,770,076 D349G probably damaging Het
Pias1 A G 9: 62,882,009 S639P possibly damaging Het
Pkhd1l1 A T 15: 44,484,424 I232F probably damaging Het
Plxnc1 C T 10: 94,837,935 R995Q probably damaging Het
Pnliprp2 T A 19: 58,774,087 S375T probably benign Het
Prkar1b C T 5: 139,020,092 V313M probably benign Het
Ptpn13 T C 5: 103,529,717 S734P probably damaging Het
Rdh1 T C 10: 127,759,941 W2R possibly damaging Het
Rsph10b A T 5: 143,949,338 I285L probably benign Het
Rubcnl T C 14: 75,047,547 F502S probably damaging Het
Ryr2 T A 13: 11,638,443 I3693F probably damaging Het
Ryr2 T C 13: 11,799,861 Y675C probably damaging Het
Scaper T C 9: 55,685,923 T477A probably benign Het
Scn2a G T 2: 65,711,925 V791L probably benign Het
Sdk1 A T 5: 142,132,065 T1573S probably damaging Het
Sema3c A T 5: 17,714,415 H483L probably benign Het
Sema6c T C 3: 95,168,691 S219P probably damaging Het
Slc10a5 T G 3: 10,335,117 E161A probably damaging Het
Slc22a23 C T 13: 34,344,383 G139S possibly damaging Het
Slc34a3 C T 2: 25,233,065 probably benign Het
Slc38a9 A T 13: 112,729,196 probably null Het
Taok1 A C 11: 77,559,844 S367R possibly damaging Het
Tlr6 G A 5: 64,954,860 Q235* probably null Het
Top2a A G 11: 98,996,839 V1281A probably benign Het
Tpgs1 T C 10: 79,675,782 Y253H probably damaging Het
Tubgcp3 T C 8: 12,653,462 T288A probably benign Het
Ubr4 A G 4: 139,426,902 E2140G probably benign Het
Uso1 A G 5: 92,174,019 Q257R probably benign Het
Zfp106 A G 2: 120,532,196 V48A probably damaging Het
Zfp174 T A 16: 3,848,254 S128T possibly damaging Het
Zscan26 T A 13: 21,445,055 D426V probably benign Het
Other mutations in Gm4788
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Gm4788 APN 1 139731574 missense probably damaging 0.99
IGL01088:Gm4788 APN 1 139698085 utr 3 prime probably benign
IGL01419:Gm4788 APN 1 139739644 critical splice acceptor site probably null
IGL01552:Gm4788 APN 1 139739302 missense probably damaging 1.00
IGL01924:Gm4788 APN 1 139739206 missense probably damaging 0.99
IGL02032:Gm4788 APN 1 139774546 missense probably damaging 1.00
IGL02254:Gm4788 APN 1 139733405 splice site probably benign
IGL02318:Gm4788 APN 1 139781097 missense probably benign 0.20
IGL02527:Gm4788 APN 1 139753045 missense probably damaging 1.00
IGL02531:Gm4788 APN 1 139774569 missense probably benign 0.10
IGL02587:Gm4788 APN 1 139701930 missense probably damaging 1.00
IGL02644:Gm4788 APN 1 139781167 start codon destroyed probably null 0.63
IGL02852:Gm4788 APN 1 139774016 missense probably damaging 1.00
IGL02963:Gm4788 APN 1 139731596 nonsense probably null
IGL03084:Gm4788 APN 1 139781142 missense possibly damaging 0.94
R0131:Gm4788 UTSW 1 139754271 missense probably damaging 0.98
R0131:Gm4788 UTSW 1 139754271 missense probably damaging 0.98
R0132:Gm4788 UTSW 1 139754271 missense probably damaging 0.98
R0549:Gm4788 UTSW 1 139739488 missense probably damaging 1.00
R0610:Gm4788 UTSW 1 139701846 missense probably benign 0.20
R1341:Gm4788 UTSW 1 139732393 missense probably damaging 0.98
R1460:Gm4788 UTSW 1 139698196 missense probably damaging 0.99
R1544:Gm4788 UTSW 1 139736870 missense probably damaging 1.00
R1873:Gm4788 UTSW 1 139774660 missense probably damaging 0.97
R2032:Gm4788 UTSW 1 139733255 splice site probably benign
R2111:Gm4788 UTSW 1 139774679 splice site probably benign
R2179:Gm4788 UTSW 1 139731541 missense probably damaging 1.00
R3806:Gm4788 UTSW 1 139753035 missense probably damaging 1.00
R4356:Gm4788 UTSW 1 139732310 missense probably damaging 1.00
R4747:Gm4788 UTSW 1 139698184 missense probably damaging 1.00
R4838:Gm4788 UTSW 1 139733443 missense probably damaging 1.00
R4867:Gm4788 UTSW 1 139774475 critical splice donor site probably null
R4910:Gm4788 UTSW 1 139774563 missense probably damaging 1.00
R4911:Gm4788 UTSW 1 139774563 missense probably damaging 1.00
R5050:Gm4788 UTSW 1 139736840 missense probably damaging 0.99
R5120:Gm4788 UTSW 1 139753103 missense probably benign 0.39
R5259:Gm4788 UTSW 1 139740495 missense probably damaging 1.00
R5504:Gm4788 UTSW 1 139701820 missense probably benign 0.18
R5825:Gm4788 UTSW 1 139774598 synonymous probably null
R5949:Gm4788 UTSW 1 139733149 missense probably damaging 0.98
R6140:Gm4788 UTSW 1 139732395 missense probably damaging 1.00
R6200:Gm4788 UTSW 1 139754335 missense probably damaging 0.97
R6254:Gm4788 UTSW 1 139754390 missense probably damaging 0.98
R6255:Gm4788 UTSW 1 139753011 nonsense probably null
R6334:Gm4788 UTSW 1 139773924 unclassified probably null
R6611:Gm4788 UTSW 1 139732390 missense probably damaging 1.00
R6798:Gm4788 UTSW 1 139698121 missense probably benign 0.20
R6800:Gm4788 UTSW 1 139701981 missense possibly damaging 0.85
R6895:Gm4788 UTSW 1 139740472 missense possibly damaging 0.84
R6904:Gm4788 UTSW 1 139731653 missense possibly damaging 0.79
R6994:Gm4788 UTSW 1 139736930 missense possibly damaging 0.67
R7173:Gm4788 UTSW 1 139731677 nonsense probably null
R7184:Gm4788 UTSW 1 139733084 missense possibly damaging 0.65
R7192:Gm4788 UTSW 1 139739295 missense probably damaging 0.96
R7205:Gm4788 UTSW 1 139753050 nonsense probably null
R7302:Gm4788 UTSW 1 139739698 intron probably null
R7308:Gm4788 UTSW 1 139754303 missense possibly damaging 0.71
R7636:Gm4788 UTSW 1 139739322 missense probably benign 0.01
R7735:Gm4788 UTSW 1 139732301 critical splice donor site probably null
R8006:Gm4788 UTSW 1 139736852 missense not run
R8045:Gm4788 UTSW 1 139733505 missense not run
X0009:Gm4788 UTSW 1 139733549 missense probably benign 0.08
X0024:Gm4788 UTSW 1 139733509 missense probably damaging 1.00
Z1088:Gm4788 UTSW 1 139754261 missense probably damaging 0.99
Z1176:Gm4788 UTSW 1 139698256 missense not run
Z1176:Gm4788 UTSW 1 139733448 missense not run
Predicted Primers PCR Primer
(F):5'- GGGTCCACTTTCCACTAAGGCAAAA -3'
(R):5'- GCAGCAGGTCAAGTAGCATCATGT -3'

Sequencing Primer
(F):5'- GGTTTCTGCACAAGTGAACTC -3'
(R):5'- TGCACAACCTCCTGAAATTCC -3'
Posted On2013-06-11