Mutagenetix > Incidental Mutations

Incidental Mutation 'R0558:Zfp106'

45698

Institutional Source

Beutler Lab

Gene Symbol

Zfp106

Ensembl Gene

ENSMUSG00000027288

Gene Name

zinc finger protein 106

Synonyms

Cd-1, H3a, Sh3bp3, sirm

MMRRC Submission

038750-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0558 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120506820-120563843 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 120532196 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 48 (V48A)

Ref Sequence

ENSEMBL: ENSMUSP00000126939 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055241] [ENSMUST00000135625] [ENSMUST00000171215]

Predicted Effect

probably damaging
Transcript: ENSMUST00000055241
AA Change: V837A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000055602
Gene: ENSMUSG00000027288
AA Change: V837A

Domain	Start	End	E-Value	Type
ZnF_C2H2	5	29	1.51e0	SMART
ZnF_C2H2	43	67	7.18e1	SMART
low complexity region	75	92	N/A	INTRINSIC
low complexity region	141	152	N/A	INTRINSIC
low complexity region	199	212	N/A	INTRINSIC
low complexity region	466	480	N/A	INTRINSIC
coiled coil region	800	823	N/A	INTRINSIC
low complexity region	842	856	N/A	INTRINSIC
low complexity region	1049	1062	N/A	INTRINSIC
low complexity region	1312	1321	N/A	INTRINSIC
low complexity region	1361	1373	N/A	INTRINSIC
low complexity region	1389	1409	N/A	INTRINSIC
WD40	1525	1562	9.24e-4	SMART
WD40	1565	1607	1.83e-7	SMART
PQQ	1587	1618	3.42e2	SMART
WD40	1651	1691	3.45e-1	SMART
PQQ	1671	1702	9.14e1	SMART
WD40	1694	1731	2.12e-3	SMART
PQQ	1711	1742	6.42e0	SMART
WD40	1734	1771	6e-3	SMART
PQQ	1751	1782	5.7e2	SMART
WD40	1774	1811	3.58e-1	SMART
ZnF_C2H2	1818	1843	5.34e-1	SMART
ZnF_C2H2	1851	1879	1.31e2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000135625
AA Change: V48A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000126939
Gene: ENSMUSG00000027288
AA Change: V48A

Domain	Start	End	E-Value	Type
ZnF_C2H2	5	29	1.51e0	SMART
low complexity region	53	67	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141874

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147353

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149210

Predicted Effect

probably benign
Transcript: ENSMUST00000163384

Predicted Effect

probably benign
Transcript: ENSMUST00000167241

SMART Domains

Protein: ENSMUSP00000127803
Gene: ENSMUSG00000027288

Domain	Start	End	E-Value	Type
ZnF_C2H2	4	28	1.51e0	SMART
low complexity region	74	85	N/A	INTRINSIC
low complexity region	132	145	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000171215
AA Change: V814A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000128995
Gene: ENSMUSG00000027288
AA Change: V814A

Domain	Start	End	E-Value	Type
ZnF_C2H2	20	44	7.18e1	SMART
low complexity region	52	69	N/A	INTRINSIC
low complexity region	118	129	N/A	INTRINSIC
low complexity region	176	189	N/A	INTRINSIC
low complexity region	443	457	N/A	INTRINSIC
coiled coil region	777	800	N/A	INTRINSIC
low complexity region	819	833	N/A	INTRINSIC
low complexity region	1026	1039	N/A	INTRINSIC
low complexity region	1289	1298	N/A	INTRINSIC
low complexity region	1338	1350	N/A	INTRINSIC
low complexity region	1366	1386	N/A	INTRINSIC
WD40	1502	1539	9.24e-4	SMART
WD40	1542	1584	1.83e-7	SMART
PQQ	1564	1595	3.42e2	SMART
WD40	1628	1668	3.45e-1	SMART
PQQ	1648	1679	9.14e1	SMART
WD40	1671	1708	2.12e-3	SMART
PQQ	1688	1719	6.42e0	SMART
WD40	1711	1748	6e-3	SMART
PQQ	1728	1759	5.7e2	SMART
WD40	1751	1788	3.58e-1	SMART
ZnF_C2H2	1795	1820	5.34e-1	SMART
ZnF_C2H2	1828	1856	1.31e2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181963

Meta Mutation Damage Score

0.0737

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.8%

Validation Efficiency

100% (80/80)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit an abnormal gait, progressive motor deficits, kyphosis, weight loss, severe adult-onset degenerative sensory-motor axonopathy, mitochondrial dysfunction, and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930017K11Rik	T	C	17: 25,947,549	N338S	probably benign	Het
Abcc2	G	A	19: 43,800,724	G273R	probably benign	Het
Adamts10	T	C	17: 33,550,609	V935A	probably benign	Het
Anapc15-ps	T	C	10: 95,673,121	D90G	probably damaging	Het
Atic	T	A	1: 71,563,788	V107E	probably benign	Het
Atp4b	T	C	8: 13,393,523	T52A	possibly damaging	Het
Cacna1h	C	T	17: 25,381,550	A1606T	probably damaging	Het
Cacng6	T	A	7: 3,434,808	Y217*	probably null	Het
Cc2d2a	T	G	5: 43,724,387		probably benign	Het
Cd226	T	A	18: 89,207,214	H78Q	probably benign	Het
Cers3	A	G	7: 66,783,418	D161G	probably damaging	Het
Ces1f	T	C	8: 93,275,389	H37R	probably benign	Het
Chek1	T	A	9: 36,712,115	N421I	possibly damaging	Het
Cma2	T	C	14: 55,972,792	Y45H	probably damaging	Het
Cmas	C	A	6: 142,775,244	Y401*	probably null	Het
Cyp2j8	A	T	4: 96,444,634	S492T	probably benign	Het
Dnah12	T	C	14: 26,709,310	S358P	probably benign	Het
Dnajc13	T	C	9: 104,201,952		probably null	Het
Ep400	A	C	5: 110,685,067		probably benign	Het
Fam209	T	A	2: 172,472,838	N82K	probably benign	Het
Fam92a	T	C	4: 12,164,095	D248G	probably damaging	Het
G3bp2	A	T	5: 92,073,197	Y20N	probably damaging	Het
Gli2	T	C	1: 118,837,649	D924G	probably benign	Het
Gm10787	T	C	10: 77,022,016		noncoding transcript	Het
Gm11568	A	G	11: 99,858,046	R26G	unknown	Het
Gm4788	A	G	1: 139,739,492	V376A	probably damaging	Het
Hivep3	T	G	4: 120,096,566	L693R	probably damaging	Het
Hook1	A	G	4: 95,993,212		probably benign	Het
Ibtk	A	C	9: 85,737,538	D116E	probably damaging	Het
Insrr	C	T	3: 87,810,981	T927I	possibly damaging	Het
Irx1	T	G	13: 71,959,628	S312R	probably benign	Het
Itga11	T	C	9: 62,752,288	Y441H	probably benign	Het
Itsn1	A	G	16: 91,899,623	D38G	possibly damaging	Het
Kat6b	G	T	14: 21,669,421	E1280D	probably benign	Het
Kcnk10	T	A	12: 98,436,301	Y293F	possibly damaging	Het
Krt74	T	A	15: 101,760,963		noncoding transcript	Het
Lars	T	G	18: 42,214,837	I974L	probably benign	Het
Limch1	A	G	5: 66,969,155	D42G	probably damaging	Het
Mau2	G	C	8: 70,042,432	T85R	probably damaging	Het
Mkrn3	A	G	7: 62,418,864	I393T	probably benign	Het
Mpl	A	C	4: 118,444,020	S541R	probably damaging	Het
Nfrkb	T	C	9: 31,410,268	S754P	possibly damaging	Het
Olfr1170	A	G	2: 88,224,474	V186A	possibly damaging	Het
Olfr1233	A	G	2: 89,340,236	L22P	probably benign	Het
Olfr1350	T	C	7: 6,570,653	Y221H	possibly damaging	Het
Olfr1537	T	A	9: 39,238,200	T75S	probably damaging	Het
P2rx7	A	T	5: 122,673,798	I391F	possibly damaging	Het
Pbrm1	T	A	14: 31,085,059		probably null	Het
Pcdh8	T	C	14: 79,770,076	D349G	probably damaging	Het
Pias1	A	G	9: 62,882,009	S639P	possibly damaging	Het
Pkhd1l1	A	T	15: 44,484,424	I232F	probably damaging	Het
Plxnc1	C	T	10: 94,837,935	R995Q	probably damaging	Het
Pnliprp2	T	A	19: 58,774,087	S375T	probably benign	Het
Prkar1b	C	T	5: 139,020,092	V313M	probably benign	Het
Ptpn13	T	C	5: 103,529,717	S734P	probably damaging	Het
Rdh1	T	C	10: 127,759,941	W2R	possibly damaging	Het
Rsph10b	A	T	5: 143,949,338	I285L	probably benign	Het
Rubcnl	T	C	14: 75,047,547	F502S	probably damaging	Het
Ryr2	T	A	13: 11,638,443	I3693F	probably damaging	Het
Ryr2	T	C	13: 11,799,861	Y675C	probably damaging	Het
Scaper	T	C	9: 55,685,923	T477A	probably benign	Het
Scn2a	G	T	2: 65,711,925	V791L	probably benign	Het
Sdk1	A	T	5: 142,132,065	T1573S	probably damaging	Het
Sema3c	A	T	5: 17,714,415	H483L	probably benign	Het
Sema6c	T	C	3: 95,168,691	S219P	probably damaging	Het
Slc10a5	T	G	3: 10,335,117	E161A	probably damaging	Het
Slc22a23	C	T	13: 34,344,383	G139S	possibly damaging	Het
Slc34a3	C	T	2: 25,233,065		probably benign	Het
Slc38a9	A	T	13: 112,729,196		probably null	Het
Taok1	A	C	11: 77,559,844	S367R	possibly damaging	Het
Tlr6	G	A	5: 64,954,860	Q235*	probably null	Het
Top2a	A	G	11: 98,996,839	V1281A	probably benign	Het
Tpgs1	T	C	10: 79,675,782	Y253H	probably damaging	Het
Tubgcp3	T	C	8: 12,653,462	T288A	probably benign	Het
Ubr4	A	G	4: 139,426,902	E2140G	probably benign	Het
Uso1	A	G	5: 92,174,019	Q257R	probably benign	Het
Zfp174	T	A	16: 3,848,254	S128T	possibly damaging	Het
Zscan26	T	A	13: 21,445,055	D426V	probably benign	Het

Other mutations in Zfp106

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00330:Zfp106	APN	2	120539497	missense	probably benign	0.45
IGL00816:Zfp106	APN	2	120526848	missense	probably benign	0.02
IGL00822:Zfp106	APN	2	120514160	missense	probably damaging	1.00
IGL00848:Zfp106	APN	2	120512727	missense	probably damaging	1.00
IGL01293:Zfp106	APN	2	120535035	missense	possibly damaging	0.92
IGL01323:Zfp106	APN	2	120524464	missense	possibly damaging	0.74
IGL01662:Zfp106	APN	2	120523553	missense	probably benign	0.17
IGL01683:Zfp106	APN	2	120524555	missense	probably benign	0.00
IGL01809:Zfp106	APN	2	120533671	missense	probably damaging	1.00
IGL01958:Zfp106	APN	2	120534807	missense	probably benign	0.26
IGL01960:Zfp106	APN	2	120524043	missense	probably damaging	0.99
IGL01960:Zfp106	APN	2	120539322	missense	probably benign	0.08
IGL02168:Zfp106	APN	2	120534231	missense	possibly damaging	0.90
IGL02623:Zfp106	APN	2	120545914	splice site	probably null
IGL02798:Zfp106	APN	2	120510510	missense	probably damaging	1.00
IGL02828:Zfp106	APN	2	120531697	missense	possibly damaging	0.86
IGL03022:Zfp106	APN	2	120528639	splice site	probably benign
IGL03308:Zfp106	APN	2	120524024	missense	probably benign	0.00
IGL03324:Zfp106	APN	2	120535387	missense	probably benign	0.01
lepton	UTSW	2	120532104	missense	probably damaging	0.98
Proton	UTSW	2	120510534	missense	probably damaging	1.00
quark	UTSW	2	120535060	nonsense	probably null
R0040_zfp106_031	UTSW	2	120531613	missense	probably damaging	1.00
string	UTSW	2	120533594	missense	probably damaging	0.96
theory	UTSW	2	120533677	nonsense	probably null
R0040:Zfp106	UTSW	2	120531613	missense	probably damaging	1.00
R0040:Zfp106	UTSW	2	120531613	missense	probably damaging	1.00
R0135:Zfp106	UTSW	2	120520487	missense	probably damaging	0.99
R0180:Zfp106	UTSW	2	120533875	missense	probably damaging	0.96
R0387:Zfp106	UTSW	2	120528472	splice site	probably null
R0680:Zfp106	UTSW	2	120527016	missense	probably damaging	1.00
R0729:Zfp106	UTSW	2	120555248	missense	probably damaging	0.99
R0828:Zfp106	UTSW	2	120535603	missense	probably benign	0.00
R1124:Zfp106	UTSW	2	120534714	missense	probably benign	0.00
R1147:Zfp106	UTSW	2	120520536	missense	probably damaging	1.00
R1147:Zfp106	UTSW	2	120520536	missense	probably damaging	1.00
R1226:Zfp106	UTSW	2	120524079	missense	probably damaging	1.00
R1239:Zfp106	UTSW	2	120533594	missense	probably damaging	0.96
R1634:Zfp106	UTSW	2	120533677	nonsense	probably null
R1754:Zfp106	UTSW	2	120533763	missense	probably damaging	0.96
R1754:Zfp106	UTSW	2	120533764	missense	probably damaging	0.98
R1755:Zfp106	UTSW	2	120535175	missense	probably damaging	1.00
R1763:Zfp106	UTSW	2	120520428	missense	probably benign	0.03
R1875:Zfp106	UTSW	2	120513615	critical splice donor site	probably null
R1903:Zfp106	UTSW	2	120526848	missense	probably benign	0.02
R1932:Zfp106	UTSW	2	120531681	missense	possibly damaging	0.80
R2070:Zfp106	UTSW	2	120523529	missense	probably benign	0.11
R2301:Zfp106	UTSW	2	120535650	missense	probably benign	0.04
R3429:Zfp106	UTSW	2	120527063	missense	probably benign	0.00
R3720:Zfp106	UTSW	2	120534599	missense	probably benign	0.01
R3875:Zfp106	UTSW	2	120534613	missense	probably benign	0.08
R3881:Zfp106	UTSW	2	120532149	missense	probably benign	0.01
R3921:Zfp106	UTSW	2	120533616	missense	probably damaging	1.00
R3923:Zfp106	UTSW	2	120534856	missense	probably damaging	0.99
R4087:Zfp106	UTSW	2	120526899	splice site	probably null
R4678:Zfp106	UTSW	2	120533740	missense	probably damaging	1.00
R4965:Zfp106	UTSW	2	120533919	missense	probably damaging	0.98
R5011:Zfp106	UTSW	2	120510534	missense	probably damaging	1.00
R5013:Zfp106	UTSW	2	120510534	missense	probably damaging	1.00
R5151:Zfp106	UTSW	2	120534727	missense	probably benign	0.01
R5227:Zfp106	UTSW	2	120523968	missense	probably benign	0.11
R5328:Zfp106	UTSW	2	120520417	missense	possibly damaging	0.73
R5403:Zfp106	UTSW	2	120534781	missense	probably benign	0.02
R5624:Zfp106	UTSW	2	120531957	missense	probably damaging	0.99
R5686:Zfp106	UTSW	2	120533507	splice site	probably null
R5691:Zfp106	UTSW	2	120524471	missense	probably damaging	0.99
R5852:Zfp106	UTSW	2	120516006	missense	probably damaging	1.00
R6032:Zfp106	UTSW	2	120535393	missense	probably benign	0.00
R6032:Zfp106	UTSW	2	120535393	missense	probably benign	0.00
R6298:Zfp106	UTSW	2	120522704	missense	probably damaging	1.00
R6409:Zfp106	UTSW	2	120532104	missense	probably damaging	0.98
R6505:Zfp106	UTSW	2	120534502	missense	probably damaging	0.99
R6598:Zfp106	UTSW	2	120535060	nonsense	probably null
R6765:Zfp106	UTSW	2	120539454	missense	probably damaging	0.96
R7013:Zfp106	UTSW	2	120531632	missense	probably damaging	0.99
R7453:Zfp106	UTSW	2	120510527	missense	probably damaging	1.00
R7453:Zfp106	UTSW	2	120545919	splice site	probably null
R7643:Zfp106	UTSW	2	120512734	missense	probably benign	0.01
R7829:Zfp106	UTSW	2	120524057	missense	possibly damaging	0.94
R7897:Zfp106	UTSW	2	120535615	nonsense	probably null
R7909:Zfp106	UTSW	2	120514219	missense	probably damaging	1.00
R8054:Zfp106	UTSW	2	120524519	missense	possibly damaging	0.93
R8124:Zfp106	UTSW	2	120524331	missense	probably benign	0.44
R8203:Zfp106	UTSW	2	120519078	missense	probably damaging	1.00
R8350:Zfp106	UTSW	2	120535618	missense
R8450:Zfp106	UTSW	2	120535618	missense
R8698:Zfp106	UTSW	2	120524119	critical splice donor site	probably null
RF008:Zfp106	UTSW	2	120524545	small deletion	probably benign
RF025:Zfp106	UTSW	2	120524545	small deletion	probably benign
X0025:Zfp106	UTSW	2	120534816	missense	probably benign
Z1088:Zfp106	UTSW	2	120530490	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCACTCAGGGCAGTATTAGGTGAAG -3'
(R):5'- AGATCTCTATTTGGGAGGGGAGCAG -3'

Sequencing Primer
(F):5'- CAGTATTAGGTGAAGGACTCTGC -3'
(R):5'- GGGAGCAGTTGTCACTAATCTAC -3'

Posted On

2013-06-11