Incidental Mutation 'R0558:Zfp106'
ID 45698
Institutional Source Beutler Lab
Gene Symbol Zfp106
Ensembl Gene ENSMUSG00000027288
Gene Name zinc finger protein 106
Synonyms Cd-1, H3a, Sh3bp3, sirm
MMRRC Submission 038750-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0558 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 120337301-120394324 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120362677 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 48 (V48A)
Ref Sequence ENSEMBL: ENSMUSP00000126939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055241] [ENSMUST00000135625] [ENSMUST00000171215]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000055241
AA Change: V837A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055602
Gene: ENSMUSG00000027288
AA Change: V837A

DomainStartEndE-ValueType
ZnF_C2H2 5 29 1.51e0 SMART
ZnF_C2H2 43 67 7.18e1 SMART
low complexity region 75 92 N/A INTRINSIC
low complexity region 141 152 N/A INTRINSIC
low complexity region 199 212 N/A INTRINSIC
low complexity region 466 480 N/A INTRINSIC
coiled coil region 800 823 N/A INTRINSIC
low complexity region 842 856 N/A INTRINSIC
low complexity region 1049 1062 N/A INTRINSIC
low complexity region 1312 1321 N/A INTRINSIC
low complexity region 1361 1373 N/A INTRINSIC
low complexity region 1389 1409 N/A INTRINSIC
WD40 1525 1562 9.24e-4 SMART
WD40 1565 1607 1.83e-7 SMART
PQQ 1587 1618 3.42e2 SMART
WD40 1651 1691 3.45e-1 SMART
PQQ 1671 1702 9.14e1 SMART
WD40 1694 1731 2.12e-3 SMART
PQQ 1711 1742 6.42e0 SMART
WD40 1734 1771 6e-3 SMART
PQQ 1751 1782 5.7e2 SMART
WD40 1774 1811 3.58e-1 SMART
ZnF_C2H2 1818 1843 5.34e-1 SMART
ZnF_C2H2 1851 1879 1.31e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135625
AA Change: V48A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126939
Gene: ENSMUSG00000027288
AA Change: V48A

DomainStartEndE-ValueType
ZnF_C2H2 5 29 1.51e0 SMART
low complexity region 53 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149210
Predicted Effect probably benign
Transcript: ENSMUST00000163384
Predicted Effect probably damaging
Transcript: ENSMUST00000171215
AA Change: V814A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128995
Gene: ENSMUSG00000027288
AA Change: V814A

DomainStartEndE-ValueType
ZnF_C2H2 20 44 7.18e1 SMART
low complexity region 52 69 N/A INTRINSIC
low complexity region 118 129 N/A INTRINSIC
low complexity region 176 189 N/A INTRINSIC
low complexity region 443 457 N/A INTRINSIC
coiled coil region 777 800 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 1026 1039 N/A INTRINSIC
low complexity region 1289 1298 N/A INTRINSIC
low complexity region 1338 1350 N/A INTRINSIC
low complexity region 1366 1386 N/A INTRINSIC
WD40 1502 1539 9.24e-4 SMART
WD40 1542 1584 1.83e-7 SMART
PQQ 1564 1595 3.42e2 SMART
WD40 1628 1668 3.45e-1 SMART
PQQ 1648 1679 9.14e1 SMART
WD40 1671 1708 2.12e-3 SMART
PQQ 1688 1719 6.42e0 SMART
WD40 1711 1748 6e-3 SMART
PQQ 1728 1759 5.7e2 SMART
WD40 1751 1788 3.58e-1 SMART
ZnF_C2H2 1795 1820 5.34e-1 SMART
ZnF_C2H2 1828 1856 1.31e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181963
Predicted Effect probably benign
Transcript: ENSMUST00000167241
SMART Domains Protein: ENSMUSP00000127803
Gene: ENSMUSG00000027288

DomainStartEndE-ValueType
ZnF_C2H2 4 28 1.51e0 SMART
low complexity region 74 85 N/A INTRINSIC
low complexity region 132 145 N/A INTRINSIC
Meta Mutation Damage Score 0.0737 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (80/80)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an abnormal gait, progressive motor deficits, kyphosis, weight loss, severe adult-onset degenerative sensory-motor axonopathy, mitochondrial dysfunction, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G A 19: 43,789,163 (GRCm39) G273R probably benign Het
Adamts10 T C 17: 33,769,583 (GRCm39) V935A probably benign Het
Anapc15-ps T C 10: 95,508,983 (GRCm39) D90G probably damaging Het
Atic T A 1: 71,602,947 (GRCm39) V107E probably benign Het
Atp4b T C 8: 13,443,523 (GRCm39) T52A possibly damaging Het
Cacna1h C T 17: 25,600,524 (GRCm39) A1606T probably damaging Het
Cacng6 T A 7: 3,483,324 (GRCm39) Y217* probably null Het
Cc2d2a T G 5: 43,881,729 (GRCm39) probably benign Het
Cd226 T A 18: 89,225,338 (GRCm39) H78Q probably benign Het
Cers3 A G 7: 66,433,166 (GRCm39) D161G probably damaging Het
Ces1f T C 8: 94,002,017 (GRCm39) H37R probably benign Het
Cfhr4 A G 1: 139,667,230 (GRCm39) V376A probably damaging Het
Chek1 T A 9: 36,623,411 (GRCm39) N421I possibly damaging Het
Cibar1 T C 4: 12,164,095 (GRCm39) D248G probably damaging Het
Cma2 T C 14: 56,210,249 (GRCm39) Y45H probably damaging Het
Cmas C A 6: 142,720,970 (GRCm39) Y401* probably null Het
Cyp2j8 A T 4: 96,332,871 (GRCm39) S492T probably benign Het
Dnah12 T C 14: 26,430,465 (GRCm39) S358P probably benign Het
Dnajc13 T C 9: 104,079,151 (GRCm39) probably null Het
Ep400 A C 5: 110,832,933 (GRCm39) probably benign Het
Fam209 T A 2: 172,314,758 (GRCm39) N82K probably benign Het
G3bp2 A T 5: 92,221,056 (GRCm39) Y20N probably damaging Het
Gli2 T C 1: 118,765,379 (GRCm39) D924G probably benign Het
Gm10787 T C 10: 76,857,850 (GRCm39) noncoding transcript Het
Gm11568 A G 11: 99,748,872 (GRCm39) R26G unknown Het
Hivep3 T G 4: 119,953,763 (GRCm39) L693R probably damaging Het
Hook1 A G 4: 95,881,449 (GRCm39) probably benign Het
Ibtk A C 9: 85,619,591 (GRCm39) D116E probably damaging Het
Insrr C T 3: 87,718,288 (GRCm39) T927I possibly damaging Het
Irx1 T G 13: 72,107,747 (GRCm39) S312R probably benign Het
Itga11 T C 9: 62,659,570 (GRCm39) Y441H probably benign Het
Itsn1 A G 16: 91,696,511 (GRCm39) D38G possibly damaging Het
Kat6b G T 14: 21,719,489 (GRCm39) E1280D probably benign Het
Kcnk10 T A 12: 98,402,560 (GRCm39) Y293F possibly damaging Het
Krt74 T A 15: 101,669,398 (GRCm39) noncoding transcript Het
Lars1 T G 18: 42,347,902 (GRCm39) I974L probably benign Het
Limch1 A G 5: 67,126,498 (GRCm39) D42G probably damaging Het
Mau2 G C 8: 70,495,082 (GRCm39) T85R probably damaging Het
Mkrn3 A G 7: 62,068,612 (GRCm39) I393T probably benign Het
Mpl A C 4: 118,301,217 (GRCm39) S541R probably damaging Het
Nfrkb T C 9: 31,321,564 (GRCm39) S754P possibly damaging Het
Or4c125 A G 2: 89,170,580 (GRCm39) L22P probably benign Het
Or5bw2 T C 7: 6,573,652 (GRCm39) Y221H possibly damaging Het
Or5d41 A G 2: 88,054,818 (GRCm39) V186A possibly damaging Het
Or8g18 T A 9: 39,149,496 (GRCm39) T75S probably damaging Het
P2rx7 A T 5: 122,811,861 (GRCm39) I391F possibly damaging Het
Pbrm1 T A 14: 30,807,016 (GRCm39) probably null Het
Pcdh8 T C 14: 80,007,516 (GRCm39) D349G probably damaging Het
Pias1 A G 9: 62,789,291 (GRCm39) S639P possibly damaging Het
Pkhd1l1 A T 15: 44,347,820 (GRCm39) I232F probably damaging Het
Plxnc1 C T 10: 94,673,797 (GRCm39) R995Q probably damaging Het
Pnliprp2 T A 19: 58,762,519 (GRCm39) S375T probably benign Het
Prkar1b C T 5: 139,005,847 (GRCm39) V313M probably benign Het
Prr35 T C 17: 26,166,523 (GRCm39) N338S probably benign Het
Ptpn13 T C 5: 103,677,583 (GRCm39) S734P probably damaging Het
Rdh1 T C 10: 127,595,810 (GRCm39) W2R possibly damaging Het
Rsph10b A T 5: 143,886,156 (GRCm39) I285L probably benign Het
Rubcnl T C 14: 75,284,987 (GRCm39) F502S probably damaging Het
Ryr2 T A 13: 11,653,329 (GRCm39) I3693F probably damaging Het
Ryr2 T C 13: 11,814,747 (GRCm39) Y675C probably damaging Het
Scaper T C 9: 55,593,207 (GRCm39) T477A probably benign Het
Scn2a G T 2: 65,542,269 (GRCm39) V791L probably benign Het
Sdk1 A T 5: 142,117,820 (GRCm39) T1573S probably damaging Het
Sema3c A T 5: 17,919,413 (GRCm39) H483L probably benign Het
Sema6c T C 3: 95,076,002 (GRCm39) S219P probably damaging Het
Slc10a5 T G 3: 10,400,177 (GRCm39) E161A probably damaging Het
Slc22a23 C T 13: 34,528,366 (GRCm39) G139S possibly damaging Het
Slc34a3 C T 2: 25,123,077 (GRCm39) probably benign Het
Slc38a9 A T 13: 112,865,730 (GRCm39) probably null Het
Taok1 A C 11: 77,450,670 (GRCm39) S367R possibly damaging Het
Tlr6 G A 5: 65,112,203 (GRCm39) Q235* probably null Het
Top2a A G 11: 98,887,665 (GRCm39) V1281A probably benign Het
Tpgs1 T C 10: 79,511,616 (GRCm39) Y253H probably damaging Het
Tubgcp3 T C 8: 12,703,462 (GRCm39) T288A probably benign Het
Ubr4 A G 4: 139,154,213 (GRCm39) E2140G probably benign Het
Uso1 A G 5: 92,321,878 (GRCm39) Q257R probably benign Het
Zfp174 T A 16: 3,666,118 (GRCm39) S128T possibly damaging Het
Zscan26 T A 13: 21,629,225 (GRCm39) D426V probably benign Het
Other mutations in Zfp106
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Zfp106 APN 2 120,369,978 (GRCm39) missense probably benign 0.45
IGL00816:Zfp106 APN 2 120,357,329 (GRCm39) missense probably benign 0.02
IGL00822:Zfp106 APN 2 120,344,641 (GRCm39) missense probably damaging 1.00
IGL00848:Zfp106 APN 2 120,343,208 (GRCm39) missense probably damaging 1.00
IGL01293:Zfp106 APN 2 120,365,516 (GRCm39) missense possibly damaging 0.92
IGL01323:Zfp106 APN 2 120,354,945 (GRCm39) missense possibly damaging 0.74
IGL01662:Zfp106 APN 2 120,354,034 (GRCm39) missense probably benign 0.17
IGL01683:Zfp106 APN 2 120,355,036 (GRCm39) missense probably benign 0.00
IGL01809:Zfp106 APN 2 120,364,152 (GRCm39) missense probably damaging 1.00
IGL01958:Zfp106 APN 2 120,365,288 (GRCm39) missense probably benign 0.26
IGL01960:Zfp106 APN 2 120,369,803 (GRCm39) missense probably benign 0.08
IGL01960:Zfp106 APN 2 120,354,524 (GRCm39) missense probably damaging 0.99
IGL02168:Zfp106 APN 2 120,364,712 (GRCm39) missense possibly damaging 0.90
IGL02623:Zfp106 APN 2 120,376,395 (GRCm39) splice site probably null
IGL02798:Zfp106 APN 2 120,340,991 (GRCm39) missense probably damaging 1.00
IGL02828:Zfp106 APN 2 120,362,178 (GRCm39) missense possibly damaging 0.86
IGL03022:Zfp106 APN 2 120,359,120 (GRCm39) splice site probably benign
IGL03308:Zfp106 APN 2 120,354,505 (GRCm39) missense probably benign 0.00
IGL03324:Zfp106 APN 2 120,365,868 (GRCm39) missense probably benign 0.01
lepton UTSW 2 120,362,585 (GRCm39) missense probably damaging 0.98
Proton UTSW 2 120,341,015 (GRCm39) missense probably damaging 1.00
quark UTSW 2 120,365,541 (GRCm39) nonsense probably null
R0040_zfp106_031 UTSW 2 120,362,094 (GRCm39) missense probably damaging 1.00
string UTSW 2 120,364,075 (GRCm39) missense probably damaging 0.96
theory UTSW 2 120,364,158 (GRCm39) nonsense probably null
R0040:Zfp106 UTSW 2 120,362,094 (GRCm39) missense probably damaging 1.00
R0040:Zfp106 UTSW 2 120,362,094 (GRCm39) missense probably damaging 1.00
R0135:Zfp106 UTSW 2 120,350,968 (GRCm39) missense probably damaging 0.99
R0180:Zfp106 UTSW 2 120,364,356 (GRCm39) missense probably damaging 0.96
R0387:Zfp106 UTSW 2 120,358,953 (GRCm39) splice site probably null
R0680:Zfp106 UTSW 2 120,357,497 (GRCm39) missense probably damaging 1.00
R0729:Zfp106 UTSW 2 120,385,729 (GRCm39) missense probably damaging 0.99
R0828:Zfp106 UTSW 2 120,366,084 (GRCm39) missense probably benign 0.00
R1124:Zfp106 UTSW 2 120,365,195 (GRCm39) missense probably benign 0.00
R1147:Zfp106 UTSW 2 120,351,017 (GRCm39) missense probably damaging 1.00
R1147:Zfp106 UTSW 2 120,351,017 (GRCm39) missense probably damaging 1.00
R1226:Zfp106 UTSW 2 120,354,560 (GRCm39) missense probably damaging 1.00
R1239:Zfp106 UTSW 2 120,364,075 (GRCm39) missense probably damaging 0.96
R1634:Zfp106 UTSW 2 120,364,158 (GRCm39) nonsense probably null
R1754:Zfp106 UTSW 2 120,364,245 (GRCm39) missense probably damaging 0.98
R1754:Zfp106 UTSW 2 120,364,244 (GRCm39) missense probably damaging 0.96
R1755:Zfp106 UTSW 2 120,365,656 (GRCm39) missense probably damaging 1.00
R1763:Zfp106 UTSW 2 120,350,909 (GRCm39) missense probably benign 0.03
R1875:Zfp106 UTSW 2 120,344,096 (GRCm39) critical splice donor site probably null
R1903:Zfp106 UTSW 2 120,357,329 (GRCm39) missense probably benign 0.02
R1932:Zfp106 UTSW 2 120,362,162 (GRCm39) missense possibly damaging 0.80
R2070:Zfp106 UTSW 2 120,354,010 (GRCm39) missense probably benign 0.11
R2301:Zfp106 UTSW 2 120,366,131 (GRCm39) missense probably benign 0.04
R3429:Zfp106 UTSW 2 120,357,544 (GRCm39) missense probably benign 0.00
R3720:Zfp106 UTSW 2 120,365,080 (GRCm39) missense probably benign 0.01
R3875:Zfp106 UTSW 2 120,365,094 (GRCm39) missense probably benign 0.08
R3881:Zfp106 UTSW 2 120,362,630 (GRCm39) missense probably benign 0.01
R3921:Zfp106 UTSW 2 120,364,097 (GRCm39) missense probably damaging 1.00
R3923:Zfp106 UTSW 2 120,365,337 (GRCm39) missense probably damaging 0.99
R4087:Zfp106 UTSW 2 120,357,380 (GRCm39) splice site probably null
R4678:Zfp106 UTSW 2 120,364,221 (GRCm39) missense probably damaging 1.00
R4965:Zfp106 UTSW 2 120,364,400 (GRCm39) missense probably damaging 0.98
R5011:Zfp106 UTSW 2 120,341,015 (GRCm39) missense probably damaging 1.00
R5013:Zfp106 UTSW 2 120,341,015 (GRCm39) missense probably damaging 1.00
R5151:Zfp106 UTSW 2 120,365,208 (GRCm39) missense probably benign 0.01
R5227:Zfp106 UTSW 2 120,354,449 (GRCm39) missense probably benign 0.11
R5328:Zfp106 UTSW 2 120,350,898 (GRCm39) missense possibly damaging 0.73
R5403:Zfp106 UTSW 2 120,365,262 (GRCm39) missense probably benign 0.02
R5624:Zfp106 UTSW 2 120,362,438 (GRCm39) missense probably damaging 0.99
R5686:Zfp106 UTSW 2 120,363,988 (GRCm39) splice site probably null
R5691:Zfp106 UTSW 2 120,354,952 (GRCm39) missense probably damaging 0.99
R5852:Zfp106 UTSW 2 120,346,487 (GRCm39) missense probably damaging 1.00
R6032:Zfp106 UTSW 2 120,365,874 (GRCm39) missense probably benign 0.00
R6032:Zfp106 UTSW 2 120,365,874 (GRCm39) missense probably benign 0.00
R6298:Zfp106 UTSW 2 120,353,185 (GRCm39) missense probably damaging 1.00
R6409:Zfp106 UTSW 2 120,362,585 (GRCm39) missense probably damaging 0.98
R6505:Zfp106 UTSW 2 120,364,983 (GRCm39) missense probably damaging 0.99
R6598:Zfp106 UTSW 2 120,365,541 (GRCm39) nonsense probably null
R6765:Zfp106 UTSW 2 120,369,935 (GRCm39) missense probably damaging 0.96
R7013:Zfp106 UTSW 2 120,362,113 (GRCm39) missense probably damaging 0.99
R7453:Zfp106 UTSW 2 120,376,400 (GRCm39) splice site probably null
R7453:Zfp106 UTSW 2 120,341,008 (GRCm39) missense probably damaging 1.00
R7643:Zfp106 UTSW 2 120,343,215 (GRCm39) missense probably benign 0.01
R7829:Zfp106 UTSW 2 120,354,538 (GRCm39) missense possibly damaging 0.94
R7897:Zfp106 UTSW 2 120,366,096 (GRCm39) nonsense probably null
R7909:Zfp106 UTSW 2 120,344,700 (GRCm39) missense probably damaging 1.00
R8054:Zfp106 UTSW 2 120,355,000 (GRCm39) missense possibly damaging 0.93
R8124:Zfp106 UTSW 2 120,354,812 (GRCm39) missense probably benign 0.44
R8203:Zfp106 UTSW 2 120,349,559 (GRCm39) missense probably damaging 1.00
R8350:Zfp106 UTSW 2 120,366,099 (GRCm39) missense
R8450:Zfp106 UTSW 2 120,366,099 (GRCm39) missense
R8698:Zfp106 UTSW 2 120,354,600 (GRCm39) critical splice donor site probably null
R8985:Zfp106 UTSW 2 120,366,077 (GRCm39) missense
R9015:Zfp106 UTSW 2 120,364,019 (GRCm39) missense probably damaging 1.00
R9036:Zfp106 UTSW 2 120,369,906 (GRCm39) missense probably damaging 1.00
R9142:Zfp106 UTSW 2 120,350,935 (GRCm39) missense probably damaging 1.00
R9154:Zfp106 UTSW 2 120,364,812 (GRCm39) nonsense probably null
R9175:Zfp106 UTSW 2 120,353,197 (GRCm39) missense probably damaging 1.00
R9529:Zfp106 UTSW 2 120,351,007 (GRCm39) missense probably damaging 0.97
R9572:Zfp106 UTSW 2 120,349,559 (GRCm39) missense probably damaging 1.00
R9581:Zfp106 UTSW 2 120,365,807 (GRCm39) missense
RF008:Zfp106 UTSW 2 120,355,026 (GRCm39) small deletion probably benign
RF025:Zfp106 UTSW 2 120,355,026 (GRCm39) small deletion probably benign
X0025:Zfp106 UTSW 2 120,365,297 (GRCm39) missense probably benign
Z1088:Zfp106 UTSW 2 120,360,971 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTCAGGGCAGTATTAGGTGAAG -3'
(R):5'- AGATCTCTATTTGGGAGGGGAGCAG -3'

Sequencing Primer
(F):5'- CAGTATTAGGTGAAGGACTCTGC -3'
(R):5'- GGGAGCAGTTGTCACTAATCTAC -3'
Posted On 2013-06-11