Incidental Mutation 'R5890:Adamts13'
ID457065
Institutional Source Beutler Lab
Gene Symbol Adamts13
Ensembl Gene ENSMUSG00000014852
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 13
SynonymsvWF-CP mRNA for von Willebrand factor-cleaving, LOC279028
MMRRC Submission 044091-MU
Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R5890 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location26973416-27009628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26986591 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 506 (R506W)
Ref Sequence ENSEMBL: ENSMUSP00000014996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014996] [ENSMUST00000102891]
Predicted Effect probably damaging
Transcript: ENSMUST00000014996
AA Change: R506W

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000014996
Gene: ENSMUSG00000014852
AA Change: R506W

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Reprolysin_4 84 287 2.3e-11 PFAM
Pfam:Reprolysin 84 291 1e-15 PFAM
Pfam:Reprolysin_3 113 237 2e-10 PFAM
Pfam:Reprolysin_2 132 281 5e-9 PFAM
TSP1 392 444 3.29e-14 SMART
TSP1 693 748 7.01e0 SMART
TSP1 750 810 3.34e-6 SMART
TSP1 904 959 5.85e0 SMART
TSP1 961 1019 2.69e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102891
AA Change: R506W

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099955
Gene: ENSMUSG00000014852
AA Change: R506W

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Reprolysin_4 84 287 8.5e-11 PFAM
Pfam:Reprolysin 96 291 4.9e-14 PFAM
Pfam:Reprolysin_3 106 237 5.6e-11 PFAM
TSP1 392 444 3.29e-14 SMART
TSP1 693 748 7.01e0 SMART
TSP1 750 810 3.34e-6 SMART
TSP1 904 959 5.85e0 SMART
TSP1 961 1019 2.69e0 SMART
Blast:TSP1 1022 1079 4e-26 BLAST
TSP1 1081 1137 4.58e-4 SMART
Blast:CUB 1196 1293 2e-39 BLAST
Blast:CUB 1303 1412 3e-63 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. In certain mouse strains (C57BL/6, for example) an intracisternal A-type particle (IAP) retrotransposon sequence is located in the intron 23 that causes an alternate splicing event resulting in a shorter transcript variants encoding shorter isoforms. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme that cleaves von Willebrand factor (VWF) in circulating blood. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in thrombocytopenia, decreased survival, and increased susceptibility to developing thrombotic thrombocytopenic purpura after shiga toxin injection. On a different background, mutants are viable and fertile. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik C T 11: 78,273,270 Q40* probably null Het
Abcc9 A G 6: 142,604,828 probably null Het
Acsm3 C A 7: 119,775,234 T303N probably benign Het
Adck5 C T 15: 76,593,585 T166M probably damaging Het
Adcy8 T A 15: 64,815,417 I413F probably damaging Het
Adgrl2 A T 3: 148,859,175 D252E probably damaging Het
Aldh16a1 T A 7: 45,144,545 T636S probably benign Het
Ampd1 C A 3: 103,090,075 F264L probably damaging Het
Arhgap17 T C 7: 123,286,758 probably benign Het
Babam2 A G 5: 32,064,807 probably benign Het
Bod1l T A 5: 41,820,578 E1131V probably benign Het
Cbs C T 17: 31,613,219 V553M probably damaging Het
Cd72 T C 4: 43,454,475 K18R probably damaging Het
Cep89 A G 7: 35,429,162 Y580C probably damaging Het
Chrnb1 T A 11: 69,792,729 I264F possibly damaging Het
Cntf A G 19: 12,763,993 W168R probably damaging Het
Cxxc1 T A 18: 74,221,166 D648E possibly damaging Het
Cyp2c68 A T 19: 39,712,492 L294Q probably damaging Het
Dab2ip T C 2: 35,715,402 S532P probably damaging Het
Defb3 G A 8: 19,295,184 C52Y probably damaging Het
Dennd5a T G 7: 109,934,221 E114A probably benign Het
Dnah12 T C 14: 26,706,884 F222L probably benign Het
Dock9 A C 14: 121,668,408 probably null Het
Fras1 A T 5: 96,645,948 H1043L probably benign Het
Gamt C A 10: 80,259,907 R63L possibly damaging Het
Gm1527 A G 3: 28,915,395 H298R probably benign Het
Gphb5 C T 12: 75,415,822 probably null Het
Greb1 A T 12: 16,733,421 V104D possibly damaging Het
Hck A G 2: 153,129,076 D86G probably damaging Het
Jhy T A 9: 40,922,662 K321* probably null Het
Kcna5 C T 6: 126,534,736 R143H probably damaging Het
Kif19a G T 11: 114,789,438 W867L possibly damaging Het
Map3k4 G A 17: 12,271,416 A376V probably damaging Het
Mars A T 10: 127,298,045 M661K probably benign Het
Mecp2 C T X: 74,035,437 V496M probably damaging Het
Mfsd2b A T 12: 4,867,651 C132S probably damaging Het
Mfsd4a T C 1: 132,038,928 Y356C probably damaging Het
Mif4gd G T 11: 115,609,362 A89E probably benign Het
Mkln1 A T 6: 31,490,547 E593D probably benign Het
Mlh1 G T 9: 111,228,495 N749K possibly damaging Het
Mrgprb2 T A 7: 48,551,959 *339C probably null Het
Nphp4 T C 4: 152,547,079 V812A probably benign Het
Nrcam G T 12: 44,576,771 V1048L probably benign Het
Obsl1 G A 1: 75,493,859 A856V probably damaging Het
Osgepl1 T A 1: 53,318,167 F163I probably damaging Het
Pcdha6 C A 18: 36,969,068 T438K possibly damaging Het
Pcdhb20 A T 18: 37,505,233 M271L probably benign Het
Phip T C 9: 82,906,952 T770A probably benign Het
Ppm1d A G 11: 85,326,908 T166A probably damaging Het
Ptprf A T 4: 118,224,735 I1102K probably benign Het
Sbsn T C 7: 30,753,267 V569A possibly damaging Het
Skida1 T A 2: 18,046,003 probably benign Het
Smg1 T A 7: 118,190,586 probably benign Het
Sorcs2 A G 5: 36,229,191 Y168H probably damaging Het
Sufu A T 19: 46,454,733 probably null Het
Tbc1d24 A T 17: 24,185,526 W215R probably damaging Het
Tenm4 T C 7: 96,902,860 L2502P probably damaging Het
Tgm4 A T 9: 123,061,638 E10V probably damaging Het
Trip11 T C 12: 101,885,972 E611G probably damaging Het
Ttn C A 2: 76,709,899 A34248S possibly damaging Het
Ube3a T A 7: 59,272,028 N49K probably damaging Het
Ube3c A G 5: 29,658,292 D855G possibly damaging Het
Ugt8a A G 3: 125,875,553 S301P probably benign Het
Wdfy4 T A 14: 33,102,577 N1295I possibly damaging Het
Wdr47 G T 3: 108,610,012 G43C probably damaging Het
Wdtc1 A C 4: 133,294,362 L601W unknown Het
Zfp236 A G 18: 82,640,151 F614S possibly damaging Het
Zfp637 T A 6: 117,845,086 D58E possibly damaging Het
Other mutations in Adamts13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Adamts13 APN 2 27005361 missense probably benign 0.04
IGL00465:Adamts13 APN 2 26973555 missense probably benign 0.32
IGL01114:Adamts13 APN 2 27005190 missense probably benign 0.41
IGL01138:Adamts13 APN 2 26983042 missense probably damaging 1.00
IGL01154:Adamts13 APN 2 27006194 missense probably benign
IGL01860:Adamts13 APN 2 26978011 missense probably damaging 0.99
IGL01924:Adamts13 APN 2 26996583 missense possibly damaging 0.80
IGL01991:Adamts13 APN 2 26990598 missense probably damaging 0.97
IGL02215:Adamts13 APN 2 26985483 missense probably damaging 1.00
IGL02415:Adamts13 APN 2 26989283 missense possibly damaging 0.95
IGL02519:Adamts13 APN 2 26978675 missense probably damaging 1.00
IGL02956:Adamts13 APN 2 26983037 missense probably benign 0.18
IGL03209:Adamts13 APN 2 26992961 missense probably benign 0.00
I1329:Adamts13 UTSW 2 26973619 missense possibly damaging 0.52
IGL02837:Adamts13 UTSW 2 26991420 missense probably benign 0.01
IGL03048:Adamts13 UTSW 2 26978699 critical splice donor site probably null
R0041:Adamts13 UTSW 2 26983974 missense probably damaging 1.00
R0217:Adamts13 UTSW 2 26996921 splice site probably benign
R0276:Adamts13 UTSW 2 26975760 missense possibly damaging 0.91
R0309:Adamts13 UTSW 2 26986989 missense probably damaging 0.99
R0348:Adamts13 UTSW 2 26981080 missense probably benign 0.13
R0369:Adamts13 UTSW 2 27005186 missense probably benign 0.00
R0386:Adamts13 UTSW 2 26986679 splice site probably null
R0553:Adamts13 UTSW 2 26991334 nonsense probably null
R0714:Adamts13 UTSW 2 26986985 splice site probably benign
R0862:Adamts13 UTSW 2 27006324 critical splice donor site probably null
R1320:Adamts13 UTSW 2 26989246 missense probably damaging 0.97
R1458:Adamts13 UTSW 2 26988354 missense probably damaging 1.00
R1473:Adamts13 UTSW 2 26981753 nonsense probably null
R1491:Adamts13 UTSW 2 26978315 missense probably damaging 1.00
R1588:Adamts13 UTSW 2 26975675 missense probably benign 0.01
R1638:Adamts13 UTSW 2 26996583 missense possibly damaging 0.80
R1724:Adamts13 UTSW 2 26991294 missense probably benign 0.00
R1924:Adamts13 UTSW 2 26984141 missense probably damaging 1.00
R2001:Adamts13 UTSW 2 26973990 missense probably benign
R2072:Adamts13 UTSW 2 27005425 missense probably benign 0.10
R2073:Adamts13 UTSW 2 27006314 missense probably damaging 1.00
R2409:Adamts13 UTSW 2 26978362 missense probably benign 0.00
R4362:Adamts13 UTSW 2 27004782 missense probably damaging 1.00
R4363:Adamts13 UTSW 2 27004782 missense probably damaging 1.00
R4422:Adamts13 UTSW 2 27005400 missense probably benign 0.00
R4769:Adamts13 UTSW 2 27008711 nonsense probably null
R4785:Adamts13 UTSW 2 26983042 missense probably damaging 1.00
R4831:Adamts13 UTSW 2 26983130 critical splice donor site probably null
R4832:Adamts13 UTSW 2 26989402 missense probably benign 0.22
R4945:Adamts13 UTSW 2 26986610 missense probably damaging 1.00
R5047:Adamts13 UTSW 2 26996910 missense probably damaging 0.98
R5126:Adamts13 UTSW 2 26996915 critical splice donor site probably null
R5161:Adamts13 UTSW 2 26993008 missense probably benign 0.00
R5394:Adamts13 UTSW 2 26986558 missense probably benign 0.00
R5557:Adamts13 UTSW 2 26973639 missense probably benign 0.05
R5660:Adamts13 UTSW 2 26996749 missense probably benign
R6168:Adamts13 UTSW 2 27004886 missense probably benign 0.37
R6536:Adamts13 UTSW 2 26975750 missense probably damaging 0.99
R6929:Adamts13 UTSW 2 27006263 nonsense probably null
R7207:Adamts13 UTSW 2 26978695 missense probably damaging 1.00
R7211:Adamts13 UTSW 2 26989298 missense probably benign 0.40
R7212:Adamts13 UTSW 2 27006314 missense probably damaging 1.00
R7392:Adamts13 UTSW 2 26989324 missense probably damaging 1.00
R7583:Adamts13 UTSW 2 26973953 missense probably benign
R7604:Adamts13 UTSW 2 27005206 missense probably benign 0.00
R7783:Adamts13 UTSW 2 26990585 missense not run
R7814:Adamts13 UTSW 2 26996549 missense probably benign
X0027:Adamts13 UTSW 2 26985546 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGGCAGGGTTACTACAACAGG -3'
(R):5'- GACTCCAAGTTTCCGTCCTG -3'

Sequencing Primer
(F):5'- CAGGGTTACTACAACAGGTTCTAAAG -3'
(R):5'- GGGCAACTCCATAGATCATCTCTC -3'
Posted On2017-02-15