Incidental Mutation 'R5890:Nphp4'
ID457078
Institutional Source Beutler Lab
Gene Symbol Nphp4
Ensembl Gene ENSMUSG00000039577
Gene Namenephronophthisis 4 (juvenile) homolog (human)
Synonymsnmf192, 4930564O18Rik
MMRRC Submission 044091-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R5890 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location152476706-152563183 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 152547079 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 812 (V812A)
Ref Sequence ENSEMBL: ENSMUSP00000080128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056567] [ENSMUST00000081393]
Predicted Effect probably benign
Transcript: ENSMUST00000056567
AA Change: V812A

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049920
Gene: ENSMUSG00000039577
AA Change: V812A

DomainStartEndE-ValueType
low complexity region 317 333 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 507 530 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081393
AA Change: V812A

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080128
Gene: ENSMUSG00000039577
AA Change: V812A

DomainStartEndE-ValueType
low complexity region 317 333 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 507 530 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142027
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in renal tubular development and function. This protein interacts with nephrocystin, and belongs to a multifunctional complex that is localized to actin- and microtubule-based structures. Mutations in this gene are associated with nephronophthisis type 4, a renal disease, and with Senior-Loken syndrome type 4, a combination of nephronophthisis and retinitis pigmentosa. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mutant mice have a mottled retina with photoreceptor degeneration and male infertility associated with oligozoospermia and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik C T 11: 78,273,270 Q40* probably null Het
Abcc9 A G 6: 142,604,828 probably null Het
Acsm3 C A 7: 119,775,234 T303N probably benign Het
Adamts13 A T 2: 26,986,591 R506W probably damaging Het
Adck5 C T 15: 76,593,585 T166M probably damaging Het
Adcy8 T A 15: 64,815,417 I413F probably damaging Het
Adgrl2 A T 3: 148,859,175 D252E probably damaging Het
Aldh16a1 T A 7: 45,144,545 T636S probably benign Het
Ampd1 C A 3: 103,090,075 F264L probably damaging Het
Arhgap17 T C 7: 123,286,758 probably benign Het
Babam2 A G 5: 32,064,807 probably benign Het
Bod1l T A 5: 41,820,578 E1131V probably benign Het
Cbs C T 17: 31,613,219 V553M probably damaging Het
Cd72 T C 4: 43,454,475 K18R probably damaging Het
Cep89 A G 7: 35,429,162 Y580C probably damaging Het
Chrnb1 T A 11: 69,792,729 I264F possibly damaging Het
Cntf A G 19: 12,763,993 W168R probably damaging Het
Cxxc1 T A 18: 74,221,166 D648E possibly damaging Het
Cyp2c68 A T 19: 39,712,492 L294Q probably damaging Het
Dab2ip T C 2: 35,715,402 S532P probably damaging Het
Defb3 G A 8: 19,295,184 C52Y probably damaging Het
Dennd5a T G 7: 109,934,221 E114A probably benign Het
Dnah12 T C 14: 26,706,884 F222L probably benign Het
Dock9 A C 14: 121,668,408 probably null Het
Fras1 A T 5: 96,645,948 H1043L probably benign Het
Gamt C A 10: 80,259,907 R63L possibly damaging Het
Gm1527 A G 3: 28,915,395 H298R probably benign Het
Gphb5 C T 12: 75,415,822 probably null Het
Greb1 A T 12: 16,733,421 V104D possibly damaging Het
Hck A G 2: 153,129,076 D86G probably damaging Het
Jhy T A 9: 40,922,662 K321* probably null Het
Kcna5 C T 6: 126,534,736 R143H probably damaging Het
Kif19a G T 11: 114,789,438 W867L possibly damaging Het
Map3k4 G A 17: 12,271,416 A376V probably damaging Het
Mars A T 10: 127,298,045 M661K probably benign Het
Mecp2 C T X: 74,035,437 V496M probably damaging Het
Mfsd2b A T 12: 4,867,651 C132S probably damaging Het
Mfsd4a T C 1: 132,038,928 Y356C probably damaging Het
Mif4gd G T 11: 115,609,362 A89E probably benign Het
Mkln1 A T 6: 31,490,547 E593D probably benign Het
Mlh1 G T 9: 111,228,495 N749K possibly damaging Het
Mrgprb2 T A 7: 48,551,959 *339C probably null Het
Nrcam G T 12: 44,576,771 V1048L probably benign Het
Obsl1 G A 1: 75,493,859 A856V probably damaging Het
Osgepl1 T A 1: 53,318,167 F163I probably damaging Het
Pcdha6 C A 18: 36,969,068 T438K possibly damaging Het
Pcdhb20 A T 18: 37,505,233 M271L probably benign Het
Phip T C 9: 82,906,952 T770A probably benign Het
Ppm1d A G 11: 85,326,908 T166A probably damaging Het
Ptprf A T 4: 118,224,735 I1102K probably benign Het
Sbsn T C 7: 30,753,267 V569A possibly damaging Het
Skida1 T A 2: 18,046,003 probably benign Het
Smg1 T A 7: 118,190,586 probably benign Het
Sorcs2 A G 5: 36,229,191 Y168H probably damaging Het
Sufu A T 19: 46,454,733 probably null Het
Tbc1d24 A T 17: 24,185,526 W215R probably damaging Het
Tenm4 T C 7: 96,902,860 L2502P probably damaging Het
Tgm4 A T 9: 123,061,638 E10V probably damaging Het
Trip11 T C 12: 101,885,972 E611G probably damaging Het
Ttn C A 2: 76,709,899 A34248S possibly damaging Het
Ube3a T A 7: 59,272,028 N49K probably damaging Het
Ube3c A G 5: 29,658,292 D855G possibly damaging Het
Ugt8a A G 3: 125,875,553 S301P probably benign Het
Wdfy4 T A 14: 33,102,577 N1295I possibly damaging Het
Wdr47 G T 3: 108,610,012 G43C probably damaging Het
Wdtc1 A C 4: 133,294,362 L601W unknown Het
Zfp236 A G 18: 82,640,151 F614S possibly damaging Het
Zfp637 T A 6: 117,845,086 D58E possibly damaging Het
Other mutations in Nphp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Nphp4 APN 4 152537309 splice site probably benign
IGL00963:Nphp4 APN 4 152537861 missense probably benign 0.01
IGL01571:Nphp4 APN 4 152556382 missense probably benign 0.21
IGL01707:Nphp4 APN 4 152538983 missense probably benign 0.00
IGL01837:Nphp4 APN 4 152488881 missense probably damaging 0.96
IGL02341:Nphp4 APN 4 152555469 splice site probably benign
IGL02558:Nphp4 APN 4 152555531 missense probably damaging 1.00
IGL02563:Nphp4 APN 4 152556220 missense probably benign 0.00
IGL02712:Nphp4 APN 4 152556275 missense probably damaging 1.00
IGL03023:Nphp4 APN 4 152524235 splice site probably null
R0280:Nphp4 UTSW 4 152551936 splice site probably benign
R0317:Nphp4 UTSW 4 152551931 critical splice donor site probably null
R0410:Nphp4 UTSW 4 152557046 missense probably benign
R0433:Nphp4 UTSW 4 152518172 missense probably benign 0.00
R0706:Nphp4 UTSW 4 152555617 missense probably damaging 0.98
R0785:Nphp4 UTSW 4 152562109 missense possibly damaging 0.58
R0890:Nphp4 UTSW 4 152498220 missense possibly damaging 0.93
R0930:Nphp4 UTSW 4 152538055 missense probably benign 0.01
R1202:Nphp4 UTSW 4 152488729 splice site probably null
R1203:Nphp4 UTSW 4 152488832 missense probably damaging 0.96
R1366:Nphp4 UTSW 4 152502926 missense probably damaging 0.96
R1452:Nphp4 UTSW 4 152547018 missense probably damaging 0.99
R1598:Nphp4 UTSW 4 152562090 missense probably benign 0.00
R1699:Nphp4 UTSW 4 152496664 missense probably damaging 0.99
R2007:Nphp4 UTSW 4 152554654 missense probably damaging 0.97
R2082:Nphp4 UTSW 4 152559364 missense probably benign 0.38
R2264:Nphp4 UTSW 4 152503008 splice site probably benign
R2280:Nphp4 UTSW 4 152557043 missense possibly damaging 0.95
R2281:Nphp4 UTSW 4 152557043 missense possibly damaging 0.95
R2926:Nphp4 UTSW 4 152518139 missense probably damaging 0.99
R3764:Nphp4 UTSW 4 152538017 splice site probably benign
R4084:Nphp4 UTSW 4 152488791 missense probably damaging 1.00
R4091:Nphp4 UTSW 4 152547018 missense probably damaging 0.97
R4240:Nphp4 UTSW 4 152555684 missense probably benign 0.07
R4701:Nphp4 UTSW 4 152496659 missense probably damaging 1.00
R4778:Nphp4 UTSW 4 152556291 missense probably benign 0.44
R4783:Nphp4 UTSW 4 152554546 missense probably benign 0.00
R4784:Nphp4 UTSW 4 152554546 missense probably benign 0.00
R4974:Nphp4 UTSW 4 152537793 missense probably damaging 1.00
R5053:Nphp4 UTSW 4 152544462 splice site probably null
R5117:Nphp4 UTSW 4 152524232 splice site probably null
R5128:Nphp4 UTSW 4 152502991 missense probably benign 0.01
R5665:Nphp4 UTSW 4 152506485 missense probably benign 0.25
R6171:Nphp4 UTSW 4 152544449 missense probably damaging 0.99
R6601:Nphp4 UTSW 4 152503007 splice site probably null
R6772:Nphp4 UTSW 4 152544406 missense probably benign 0.07
R6806:Nphp4 UTSW 4 152538101 missense probably benign 0.02
R7006:Nphp4 UTSW 4 152488802 missense probably benign 0.12
R7124:Nphp4 UTSW 4 152555684 missense probably benign 0.07
R7381:Nphp4 UTSW 4 152499003 missense possibly damaging 0.94
R7411:Nphp4 UTSW 4 152554717 missense probably benign 0.25
R7638:Nphp4 UTSW 4 152554534 missense probably benign 0.08
R7814:Nphp4 UTSW 4 152524272 missense possibly damaging 0.93
R7814:Nphp4 UTSW 4 152544403 missense probably damaging 1.00
R7841:Nphp4 UTSW 4 152496683 missense probably benign 0.01
T0970:Nphp4 UTSW 4 152556379 missense probably damaging 1.00
X0058:Nphp4 UTSW 4 152559707 missense possibly damaging 0.95
Z1177:Nphp4 UTSW 4 152518196 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACCCTCAGGAGTCTGCTG -3'
(R):5'- AGAAGGGTGATTCCAAGCTC -3'

Sequencing Primer
(F):5'- TGTCCGTGGTTAGACCCCAG -3'
(R):5'- AAGGGTGATTCCAAGCTCCTGTC -3'
Posted On2017-02-15