Incidental Mutation 'R5890:Jhy'
ID457101
Institutional Source Beutler Lab
Gene Symbol Jhy
Ensembl Gene ENSMUSG00000032023
Gene Namejunctional cadherin complex regulator
Synonyms4931429I11Rik
MMRRC Submission 044091-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5890 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location40894849-40964118 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 40922662 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 321 (K321*)
Ref Sequence ENSEMBL: ENSMUSP00000034521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034521]
Predicted Effect probably null
Transcript: ENSMUST00000034521
AA Change: K321*
SMART Domains Protein: ENSMUSP00000034521
Gene: ENSMUSG00000032023
AA Change: K321*

DomainStartEndE-ValueType
low complexity region 42 51 N/A INTRINSIC
low complexity region 71 85 N/A INTRINSIC
low complexity region 216 229 N/A INTRINSIC
low complexity region 383 398 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
Pfam:DUF4591 648 767 7.2e-38 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hydrocephalus, domed cranium, ataxia, weight loss, enlarged lateral ventricle, neuodegeneration, abnormal brain ependymal motile cilium and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik C T 11: 78,273,270 Q40* probably null Het
Abcc9 A G 6: 142,604,828 probably null Het
Acsm3 C A 7: 119,775,234 T303N probably benign Het
Adamts13 A T 2: 26,986,591 R506W probably damaging Het
Adck5 C T 15: 76,593,585 T166M probably damaging Het
Adcy8 T A 15: 64,815,417 I413F probably damaging Het
Adgrl2 A T 3: 148,859,175 D252E probably damaging Het
Aldh16a1 T A 7: 45,144,545 T636S probably benign Het
Ampd1 C A 3: 103,090,075 F264L probably damaging Het
Arhgap17 T C 7: 123,286,758 probably benign Het
Babam2 A G 5: 32,064,807 probably benign Het
Bod1l T A 5: 41,820,578 E1131V probably benign Het
Cbs C T 17: 31,613,219 V553M probably damaging Het
Cd72 T C 4: 43,454,475 K18R probably damaging Het
Cep89 A G 7: 35,429,162 Y580C probably damaging Het
Chrnb1 T A 11: 69,792,729 I264F possibly damaging Het
Cntf A G 19: 12,763,993 W168R probably damaging Het
Cxxc1 T A 18: 74,221,166 D648E possibly damaging Het
Cyp2c68 A T 19: 39,712,492 L294Q probably damaging Het
Dab2ip T C 2: 35,715,402 S532P probably damaging Het
Defb3 G A 8: 19,295,184 C52Y probably damaging Het
Dennd5a T G 7: 109,934,221 E114A probably benign Het
Dnah12 T C 14: 26,706,884 F222L probably benign Het
Dock9 A C 14: 121,668,408 probably null Het
Fras1 A T 5: 96,645,948 H1043L probably benign Het
Gamt C A 10: 80,259,907 R63L possibly damaging Het
Gm1527 A G 3: 28,915,395 H298R probably benign Het
Gphb5 C T 12: 75,415,822 probably null Het
Greb1 A T 12: 16,733,421 V104D possibly damaging Het
Hck A G 2: 153,129,076 D86G probably damaging Het
Kcna5 C T 6: 126,534,736 R143H probably damaging Het
Kif19a G T 11: 114,789,438 W867L possibly damaging Het
Map3k4 G A 17: 12,271,416 A376V probably damaging Het
Mars A T 10: 127,298,045 M661K probably benign Het
Mecp2 C T X: 74,035,437 V496M probably damaging Het
Mfsd2b A T 12: 4,867,651 C132S probably damaging Het
Mfsd4a T C 1: 132,038,928 Y356C probably damaging Het
Mif4gd G T 11: 115,609,362 A89E probably benign Het
Mkln1 A T 6: 31,490,547 E593D probably benign Het
Mlh1 G T 9: 111,228,495 N749K possibly damaging Het
Mrgprb2 T A 7: 48,551,959 *339C probably null Het
Nphp4 T C 4: 152,547,079 V812A probably benign Het
Nrcam G T 12: 44,576,771 V1048L probably benign Het
Obsl1 G A 1: 75,493,859 A856V probably damaging Het
Osgepl1 T A 1: 53,318,167 F163I probably damaging Het
Pcdha6 C A 18: 36,969,068 T438K possibly damaging Het
Pcdhb20 A T 18: 37,505,233 M271L probably benign Het
Phip T C 9: 82,906,952 T770A probably benign Het
Ppm1d A G 11: 85,326,908 T166A probably damaging Het
Ptprf A T 4: 118,224,735 I1102K probably benign Het
Sbsn T C 7: 30,753,267 V569A possibly damaging Het
Skida1 T A 2: 18,046,003 probably benign Het
Smg1 T A 7: 118,190,586 probably benign Het
Sorcs2 A G 5: 36,229,191 Y168H probably damaging Het
Sufu A T 19: 46,454,733 probably null Het
Tbc1d24 A T 17: 24,185,526 W215R probably damaging Het
Tenm4 T C 7: 96,902,860 L2502P probably damaging Het
Tgm4 A T 9: 123,061,638 E10V probably damaging Het
Trip11 T C 12: 101,885,972 E611G probably damaging Het
Ttn C A 2: 76,709,899 A34248S possibly damaging Het
Ube3a T A 7: 59,272,028 N49K probably damaging Het
Ube3c A G 5: 29,658,292 D855G possibly damaging Het
Ugt8a A G 3: 125,875,553 S301P probably benign Het
Wdfy4 T A 14: 33,102,577 N1295I possibly damaging Het
Wdr47 G T 3: 108,610,012 G43C probably damaging Het
Wdtc1 A C 4: 133,294,362 L601W unknown Het
Zfp236 A G 18: 82,640,151 F614S possibly damaging Het
Zfp637 T A 6: 117,845,086 D58E possibly damaging Het
Other mutations in Jhy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Jhy APN 9 40922752 missense probably benign 0.00
IGL00784:Jhy APN 9 40922752 missense probably benign 0.00
IGL01370:Jhy APN 9 40917142 missense probably benign 0.00
IGL01433:Jhy APN 9 40917216 missense possibly damaging 0.58
IGL01618:Jhy APN 9 40960964 missense possibly damaging 0.88
IGL01981:Jhy APN 9 40895546 missense probably damaging 1.00
IGL02047:Jhy APN 9 40917180 missense probably benign 0.00
IGL02076:Jhy APN 9 40917378 nonsense probably null
IGL02093:Jhy APN 9 40944867 splice site probably null
IGL02177:Jhy APN 9 40898257 missense probably damaging 1.00
IGL02406:Jhy APN 9 40910989 missense probably damaging 1.00
IGL02548:Jhy APN 9 40917175 nonsense probably null
IGL02550:Jhy APN 9 40917170 missense probably benign 0.26
IGL02651:Jhy APN 9 40917335 missense probably damaging 1.00
IGL03080:Jhy APN 9 40944357 missense probably damaging 1.00
IGL03168:Jhy APN 9 40917552 missense possibly damaging 0.92
IGL03384:Jhy APN 9 40960932 missense probably benign 0.01
R0980:Jhy UTSW 9 40944837 missense possibly damaging 0.91
R1703:Jhy UTSW 9 40944837 missense probably damaging 1.00
R1711:Jhy UTSW 9 40911157 nonsense probably null
R1767:Jhy UTSW 9 40961148 missense probably benign 0.07
R2371:Jhy UTSW 9 40917482 missense probably benign 0.32
R2432:Jhy UTSW 9 40960886 missense probably benign 0.21
R3840:Jhy UTSW 9 40944846 missense probably benign 0.09
R3841:Jhy UTSW 9 40944846 missense probably benign 0.09
R4368:Jhy UTSW 9 40917144 missense possibly damaging 0.95
R4569:Jhy UTSW 9 40911093 missense probably benign
R4570:Jhy UTSW 9 40911093 missense probably benign
R4669:Jhy UTSW 9 40961153 missense probably benign 0.03
R4762:Jhy UTSW 9 40911198 missense probably benign
R4902:Jhy UTSW 9 40897525 intron probably benign
R4932:Jhy UTSW 9 40961003 missense possibly damaging 0.66
R5704:Jhy UTSW 9 40897438 missense probably damaging 0.99
R6701:Jhy UTSW 9 40917591 missense probably damaging 0.99
R7110:Jhy UTSW 9 40917260 missense probably damaging 1.00
R7266:Jhy UTSW 9 40961157 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCAAAAGCAGTTAGGGTTGC -3'
(R):5'- ACATAAAGCCTGCCTCTGCG -3'

Sequencing Primer
(F):5'- CAGTTAGGGTTGCTGGCG -3'
(R):5'- CCCCATGGCTATAAGGTTGAAATG -3'
Posted On2017-02-15