Incidental Mutation 'R5890:Mars'
ID457106
Institutional Source Beutler Lab
Gene Symbol Mars
Ensembl Gene ENSMUSG00000040354
Gene Namemethionine-tRNA synthetase
Synonymsmethionine tRNA ligase, MetRS, methionyl-tRNA synthetase
MMRRC Submission 044091-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R5890 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location127296221-127311786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127298045 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 661 (M661K)
Ref Sequence ENSEMBL: ENSMUSP00000130666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026475] [ENSMUST00000037290] [ENSMUST00000139091] [ENSMUST00000171564] [ENSMUST00000230446]
Predicted Effect probably benign
Transcript: ENSMUST00000026475
SMART Domains Protein: ENSMUSP00000026475
Gene: ENSMUSG00000025408

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
BRLZ 94 160 1.23e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000037290
AA Change: M661K

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000037446
Gene: ENSMUSG00000040354
AA Change: M661K

DomainStartEndE-ValueType
PDB:4BL7|A 1 220 1e-118 PDB
low complexity region 221 233 N/A INTRINSIC
Pfam:tRNA-synt_1g 268 660 6.8e-142 PFAM
WHEP-TRS 847 902 7.95e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134686
Predicted Effect probably benign
Transcript: ENSMUST00000134778
SMART Domains Protein: ENSMUSP00000118031
Gene: ENSMUSG00000040354

DomainStartEndE-ValueType
SCOP:d1f4la1 5 91 2e-10 SMART
WHEP-TRS 129 184 7.95e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139091
SMART Domains Protein: ENSMUSP00000118339
Gene: ENSMUSG00000025408

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
BRLZ 94 160 1.23e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145275
Predicted Effect probably benign
Transcript: ENSMUST00000171564
AA Change: M661K

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000130666
Gene: ENSMUSG00000040354
AA Change: M661K

DomainStartEndE-ValueType
low complexity region 17 26 N/A INTRINSIC
Pfam:GST_C 94 180 1e-6 PFAM
low complexity region 205 213 N/A INTRINSIC
low complexity region 221 233 N/A INTRINSIC
Pfam:tRNA-synt_1g 268 660 9.6e-149 PFAM
WHEP-TRS 855 910 7.95e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000230446
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: The encoded protein belongs to the class I family of tRNA synthetases, a class of enzymes that charge tRNAs with their cognate amino acids. The related human gene product is essential for the translation initiation of mRNAs. This gene has an overlapping 3' UTR tail-to-tail arrangement with an adjacent gene on the opposite strand that encodes an inhibitor of the CCAAT/enhancer-binding protein's DNA binding activity. This arrangement, conserved in human and mouse, may be involved in mRNA stability and possible functional and regulatory interaction of these adjacent overlapping genes. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik C T 11: 78,273,270 Q40* probably null Het
Abcc9 A G 6: 142,604,828 probably null Het
Acsm3 C A 7: 119,775,234 T303N probably benign Het
Adamts13 A T 2: 26,986,591 R506W probably damaging Het
Adck5 C T 15: 76,593,585 T166M probably damaging Het
Adcy8 T A 15: 64,815,417 I413F probably damaging Het
Adgrl2 A T 3: 148,859,175 D252E probably damaging Het
Aldh16a1 T A 7: 45,144,545 T636S probably benign Het
Ampd1 C A 3: 103,090,075 F264L probably damaging Het
Arhgap17 T C 7: 123,286,758 probably benign Het
Babam2 A G 5: 32,064,807 probably benign Het
Bod1l T A 5: 41,820,578 E1131V probably benign Het
Cbs C T 17: 31,613,219 V553M probably damaging Het
Cd72 T C 4: 43,454,475 K18R probably damaging Het
Cep89 A G 7: 35,429,162 Y580C probably damaging Het
Chrnb1 T A 11: 69,792,729 I264F possibly damaging Het
Cntf A G 19: 12,763,993 W168R probably damaging Het
Cxxc1 T A 18: 74,221,166 D648E possibly damaging Het
Cyp2c68 A T 19: 39,712,492 L294Q probably damaging Het
Dab2ip T C 2: 35,715,402 S532P probably damaging Het
Defb3 G A 8: 19,295,184 C52Y probably damaging Het
Dennd5a T G 7: 109,934,221 E114A probably benign Het
Dnah12 T C 14: 26,706,884 F222L probably benign Het
Dock9 A C 14: 121,668,408 probably null Het
Fras1 A T 5: 96,645,948 H1043L probably benign Het
Gamt C A 10: 80,259,907 R63L possibly damaging Het
Gm1527 A G 3: 28,915,395 H298R probably benign Het
Gphb5 C T 12: 75,415,822 probably null Het
Greb1 A T 12: 16,733,421 V104D possibly damaging Het
Hck A G 2: 153,129,076 D86G probably damaging Het
Jhy T A 9: 40,922,662 K321* probably null Het
Kcna5 C T 6: 126,534,736 R143H probably damaging Het
Kif19a G T 11: 114,789,438 W867L possibly damaging Het
Map3k4 G A 17: 12,271,416 A376V probably damaging Het
Mecp2 C T X: 74,035,437 V496M probably damaging Het
Mfsd2b A T 12: 4,867,651 C132S probably damaging Het
Mfsd4a T C 1: 132,038,928 Y356C probably damaging Het
Mif4gd G T 11: 115,609,362 A89E probably benign Het
Mkln1 A T 6: 31,490,547 E593D probably benign Het
Mlh1 G T 9: 111,228,495 N749K possibly damaging Het
Mrgprb2 T A 7: 48,551,959 *339C probably null Het
Nphp4 T C 4: 152,547,079 V812A probably benign Het
Nrcam G T 12: 44,576,771 V1048L probably benign Het
Obsl1 G A 1: 75,493,859 A856V probably damaging Het
Osgepl1 T A 1: 53,318,167 F163I probably damaging Het
Pcdha6 C A 18: 36,969,068 T438K possibly damaging Het
Pcdhb20 A T 18: 37,505,233 M271L probably benign Het
Phip T C 9: 82,906,952 T770A probably benign Het
Ppm1d A G 11: 85,326,908 T166A probably damaging Het
Ptprf A T 4: 118,224,735 I1102K probably benign Het
Sbsn T C 7: 30,753,267 V569A possibly damaging Het
Skida1 T A 2: 18,046,003 probably benign Het
Smg1 T A 7: 118,190,586 probably benign Het
Sorcs2 A G 5: 36,229,191 Y168H probably damaging Het
Sufu A T 19: 46,454,733 probably null Het
Tbc1d24 A T 17: 24,185,526 W215R probably damaging Het
Tenm4 T C 7: 96,902,860 L2502P probably damaging Het
Tgm4 A T 9: 123,061,638 E10V probably damaging Het
Trip11 T C 12: 101,885,972 E611G probably damaging Het
Ttn C A 2: 76,709,899 A34248S possibly damaging Het
Ube3a T A 7: 59,272,028 N49K probably damaging Het
Ube3c A G 5: 29,658,292 D855G possibly damaging Het
Ugt8a A G 3: 125,875,553 S301P probably benign Het
Wdfy4 T A 14: 33,102,577 N1295I possibly damaging Het
Wdr47 G T 3: 108,610,012 G43C probably damaging Het
Wdtc1 A C 4: 133,294,362 L601W unknown Het
Zfp236 A G 18: 82,640,151 F614S possibly damaging Het
Zfp637 T A 6: 117,845,086 D58E possibly damaging Het
Other mutations in Mars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Mars APN 10 127298006 missense probably benign 0.31
IGL00813:Mars APN 10 127300047 missense probably damaging 1.00
IGL01292:Mars APN 10 127305518 missense probably damaging 1.00
IGL01718:Mars APN 10 127305838 missense possibly damaging 0.95
IGL02505:Mars APN 10 127304244 nonsense probably null
IGL02986:Mars APN 10 127297569 missense probably benign 0.09
PIT4366001:Mars UTSW 10 127299398 missense possibly damaging 0.72
R0149:Mars UTSW 10 127300034 missense probably damaging 1.00
R1445:Mars UTSW 10 127297988 missense possibly damaging 0.75
R1702:Mars UTSW 10 127310079 missense possibly damaging 0.52
R1998:Mars UTSW 10 127300478 nonsense probably null
R1998:Mars UTSW 10 127302871 missense probably benign
R2089:Mars UTSW 10 127299285 missense probably damaging 1.00
R2091:Mars UTSW 10 127299285 missense probably damaging 1.00
R2091:Mars UTSW 10 127299285 missense probably damaging 1.00
R4597:Mars UTSW 10 127300453 missense probably damaging 1.00
R4809:Mars UTSW 10 127300215 missense probably damaging 1.00
R4923:Mars UTSW 10 127296680 unclassified probably benign
R5563:Mars UTSW 10 127308661 missense probably benign
R5895:Mars UTSW 10 127296549 missense probably benign 0.01
R5986:Mars UTSW 10 127304302 nonsense probably null
R6300:Mars UTSW 10 127296560 missense probably benign 0.00
R7267:Mars UTSW 10 127308586 missense probably benign
R7544:Mars UTSW 10 127311610 missense probably benign 0.24
R7573:Mars UTSW 10 127302810 critical splice donor site probably null
R7740:Mars UTSW 10 127300575 missense probably benign 0.16
R7884:Mars UTSW 10 127300245 missense probably damaging 0.99
R7967:Mars UTSW 10 127300245 missense probably damaging 0.99
X0027:Mars UTSW 10 127308349 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTGTATAGGGCTGCAAGC -3'
(R):5'- GCCATGGGAGTTAAGTCTTCC -3'

Sequencing Primer
(F):5'- GCCATACCAACATATCACTGACTAG -3'
(R):5'- TAGTGTGCCATGAACATCAGC -3'
Posted On2017-02-15