Incidental Mutation 'R5890:Chrnb1'
ID457107
Institutional Source Beutler Lab
Gene Symbol Chrnb1
Ensembl Gene ENSMUSG00000041189
Gene Namecholinergic receptor, nicotinic, beta polypeptide 1 (muscle)
SynonymsAChR beta, Acrb, Achr-2
MMRRC Submission 044091-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.583) question?
Stock #R5890 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69784036-69795943 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69792729 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 264 (I264F)
Ref Sequence ENSEMBL: ENSMUSP00000047270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011285] [ENSMUST00000045971] [ENSMUST00000102585]
Predicted Effect probably benign
Transcript: ENSMUST00000011285
SMART Domains Protein: ENSMUSP00000011285
Gene: ENSMUSG00000042826

DomainStartEndE-ValueType
FGF 69 172 6.95e-35 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000045971
AA Change: I264F

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047270
Gene: ENSMUSG00000041189
AA Change: I264F

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:Neur_chan_LBD 27 245 3.6e-65 PFAM
Pfam:Neur_chan_memb 252 487 3.5e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102585
SMART Domains Protein: ENSMUSP00000099645
Gene: ENSMUSG00000042826

DomainStartEndE-ValueType
FGF 69 200 3.43e-66 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154816
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscle acetylcholine receptor is composed of five subunits: two alpha subunits and one beta, one gamma, and one delta subunit. This gene encodes the beta subunit of the acetylcholine receptor. The acetylcholine receptor changes conformation upon acetylcholine binding leading to the opening of an ion-conducting channel across the plasma membrane. Mutations in this gene are associated with slow-channel congenital myasthenic syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele lack all tyrosine residues in the beta subunit intracellular loop, display reduced and simplified neuromuscular junctions, and show defective acetylcholine receptor clustering and anchoring at synapses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik C T 11: 78,273,270 Q40* probably null Het
Abcc9 A G 6: 142,604,828 probably null Het
Acsm3 C A 7: 119,775,234 T303N probably benign Het
Adamts13 A T 2: 26,986,591 R506W probably damaging Het
Adck5 C T 15: 76,593,585 T166M probably damaging Het
Adcy8 T A 15: 64,815,417 I413F probably damaging Het
Adgrl2 A T 3: 148,859,175 D252E probably damaging Het
Aldh16a1 T A 7: 45,144,545 T636S probably benign Het
Ampd1 C A 3: 103,090,075 F264L probably damaging Het
Arhgap17 T C 7: 123,286,758 probably benign Het
Babam2 A G 5: 32,064,807 probably benign Het
Bod1l T A 5: 41,820,578 E1131V probably benign Het
Cbs C T 17: 31,613,219 V553M probably damaging Het
Cd72 T C 4: 43,454,475 K18R probably damaging Het
Cep89 A G 7: 35,429,162 Y580C probably damaging Het
Cntf A G 19: 12,763,993 W168R probably damaging Het
Cxxc1 T A 18: 74,221,166 D648E possibly damaging Het
Cyp2c68 A T 19: 39,712,492 L294Q probably damaging Het
Dab2ip T C 2: 35,715,402 S532P probably damaging Het
Defb3 G A 8: 19,295,184 C52Y probably damaging Het
Dennd5a T G 7: 109,934,221 E114A probably benign Het
Dnah12 T C 14: 26,706,884 F222L probably benign Het
Dock9 A C 14: 121,668,408 probably null Het
Fras1 A T 5: 96,645,948 H1043L probably benign Het
Gamt C A 10: 80,259,907 R63L possibly damaging Het
Gm1527 A G 3: 28,915,395 H298R probably benign Het
Gphb5 C T 12: 75,415,822 probably null Het
Greb1 A T 12: 16,733,421 V104D possibly damaging Het
Hck A G 2: 153,129,076 D86G probably damaging Het
Jhy T A 9: 40,922,662 K321* probably null Het
Kcna5 C T 6: 126,534,736 R143H probably damaging Het
Kif19a G T 11: 114,789,438 W867L possibly damaging Het
Map3k4 G A 17: 12,271,416 A376V probably damaging Het
Mars A T 10: 127,298,045 M661K probably benign Het
Mecp2 C T X: 74,035,437 V496M probably damaging Het
Mfsd2b A T 12: 4,867,651 C132S probably damaging Het
Mfsd4a T C 1: 132,038,928 Y356C probably damaging Het
Mif4gd G T 11: 115,609,362 A89E probably benign Het
Mkln1 A T 6: 31,490,547 E593D probably benign Het
Mlh1 G T 9: 111,228,495 N749K possibly damaging Het
Mrgprb2 T A 7: 48,551,959 *339C probably null Het
Nphp4 T C 4: 152,547,079 V812A probably benign Het
Nrcam G T 12: 44,576,771 V1048L probably benign Het
Obsl1 G A 1: 75,493,859 A856V probably damaging Het
Osgepl1 T A 1: 53,318,167 F163I probably damaging Het
Pcdha6 C A 18: 36,969,068 T438K possibly damaging Het
Pcdhb20 A T 18: 37,505,233 M271L probably benign Het
Phip T C 9: 82,906,952 T770A probably benign Het
Ppm1d A G 11: 85,326,908 T166A probably damaging Het
Ptprf A T 4: 118,224,735 I1102K probably benign Het
Sbsn T C 7: 30,753,267 V569A possibly damaging Het
Skida1 T A 2: 18,046,003 probably benign Het
Smg1 T A 7: 118,190,586 probably benign Het
Sorcs2 A G 5: 36,229,191 Y168H probably damaging Het
Sufu A T 19: 46,454,733 probably null Het
Tbc1d24 A T 17: 24,185,526 W215R probably damaging Het
Tenm4 T C 7: 96,902,860 L2502P probably damaging Het
Tgm4 A T 9: 123,061,638 E10V probably damaging Het
Trip11 T C 12: 101,885,972 E611G probably damaging Het
Ttn C A 2: 76,709,899 A34248S possibly damaging Het
Ube3a T A 7: 59,272,028 N49K probably damaging Het
Ube3c A G 5: 29,658,292 D855G possibly damaging Het
Ugt8a A G 3: 125,875,553 S301P probably benign Het
Wdfy4 T A 14: 33,102,577 N1295I possibly damaging Het
Wdr47 G T 3: 108,610,012 G43C probably damaging Het
Wdtc1 A C 4: 133,294,362 L601W unknown Het
Zfp236 A G 18: 82,640,151 F614S possibly damaging Het
Zfp637 T A 6: 117,845,086 D58E possibly damaging Het
Other mutations in Chrnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Chrnb1 APN 11 69793916 missense probably damaging 1.00
IGL01924:Chrnb1 APN 11 69795019 unclassified probably benign
IGL01983:Chrnb1 APN 11 69795729 missense probably benign 0.27
IGL02100:Chrnb1 APN 11 69793455 unclassified probably benign
IGL02507:Chrnb1 APN 11 69785090 missense probably damaging 1.00
IGL02814:Chrnb1 APN 11 69795680 missense probably damaging 1.00
IGL02858:Chrnb1 APN 11 69785109 missense possibly damaging 0.58
R0368:Chrnb1 UTSW 11 69784757 missense probably damaging 1.00
R1728:Chrnb1 UTSW 11 69785762 missense probably damaging 1.00
R1913:Chrnb1 UTSW 11 69793584 missense possibly damaging 0.95
R1930:Chrnb1 UTSW 11 69792737 missense possibly damaging 0.81
R2233:Chrnb1 UTSW 11 69795602 missense probably damaging 0.98
R2234:Chrnb1 UTSW 11 69795602 missense probably damaging 0.98
R3971:Chrnb1 UTSW 11 69792916 unclassified probably benign
R4183:Chrnb1 UTSW 11 69787096 missense possibly damaging 0.50
R4425:Chrnb1 UTSW 11 69786947 missense probably damaging 1.00
R4822:Chrnb1 UTSW 11 69795675 missense possibly damaging 0.55
R4983:Chrnb1 UTSW 11 69793978 missense probably damaging 1.00
R5000:Chrnb1 UTSW 11 69787032 missense probably damaging 0.96
R5378:Chrnb1 UTSW 11 69785181 missense probably benign 0.00
R5396:Chrnb1 UTSW 11 69794153 missense probably damaging 1.00
R5540:Chrnb1 UTSW 11 69795650 missense probably benign 0.30
R5574:Chrnb1 UTSW 11 69793683 unclassified probably benign
R5973:Chrnb1 UTSW 11 69795845 unclassified probably benign
R6056:Chrnb1 UTSW 11 69786939 missense probably damaging 1.00
R7466:Chrnb1 UTSW 11 69784650 missense probably damaging 1.00
R7633:Chrnb1 UTSW 11 69792873 missense probably damaging 1.00
R7664:Chrnb1 UTSW 11 69787024 missense possibly damaging 0.80
Z1177:Chrnb1 UTSW 11 69794189 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGGCCTGGAACTCAAAGACC -3'
(R):5'- TCTCCCTCCTCCAGAGAATG -3'

Sequencing Primer
(F):5'- TGGAACTCAAAGACCTGCCTG -3'
(R):5'- AGAATGGCCAATGGGAGATTATC -3'
Posted On2017-02-15