Mutagenetix > Incidental Mutations

Incidental Mutation 'R5890:Trip11'

457119

Institutional Source

Beutler Lab

Gene Symbol

Trip11

Ensembl Gene

ENSMUSG00000021188

Gene Name

thyroid hormone receptor interactor 11

Synonyms

GMAP-210, 3110031G15Rik, 2610511G22Rik, 6030460N08Rik, TRIP230

MMRRC Submission

044091-MU

Accession Numbers

Genbank: NM_028446.1; Ensembl: ENSMUST00000021605, ENSMUST00000085086, ENSMUST00000110038

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5890 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101834043-101913267 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 101885972 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 611 (E611G)

Ref Sequence

ENSEMBL: ENSMUSP00000021605 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021605] [ENSMUST00000176728] [ENSMUST00000177183] [ENSMUST00000177536]

Predicted Effect

probably damaging
Transcript: ENSMUST00000021605
AA Change: E611G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000021605
Gene: ENSMUSG00000021188
AA Change: E611G

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
coiled coil region	54	130	N/A	INTRINSIC
coiled coil region	167	194	N/A	INTRINSIC
coiled coil region	218	702	N/A	INTRINSIC
coiled coil region	754	990	N/A	INTRINSIC
coiled coil region	1022	1051	N/A	INTRINSIC
coiled coil region	1196	1261	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
coiled coil region	1336	1481	N/A	INTRINSIC
coiled coil region	1547	1657	N/A	INTRINSIC
coiled coil region	1681	1771	N/A	INTRINSIC
low complexity region	1934	1945	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176728

SMART Domains

Protein: ENSMUSP00000134992
Gene: ENSMUSG00000021188

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
Pfam:Orthopox_A5L	48	282	6.5e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177183
AA Change: E326G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000134976
Gene: ENSMUSG00000021188
AA Change: E326G

Domain	Start	End	E-Value	Type
coiled coil region	33	158	N/A	INTRINSIC
coiled coil region	179	417	N/A	INTRINSIC
coiled coil region	469	705	N/A	INTRINSIC
coiled coil region	737	766	N/A	INTRINSIC
coiled coil region	911	976	N/A	INTRINSIC
low complexity region	1025	1037	N/A	INTRINSIC
coiled coil region	1051	1196	N/A	INTRINSIC
coiled coil region	1262	1372	N/A	INTRINSIC
coiled coil region	1396	1486	N/A	INTRINSIC
low complexity region	1649	1660	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177480

Predicted Effect

probably benign
Transcript: ENSMUST00000177536

SMART Domains

Protein: ENSMUSP00000135669
Gene: ENSMUSG00000021188

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
coiled coil region	53	129	N/A	INTRINSIC
coiled coil region	166	193	N/A	INTRINSIC
coiled coil region	217	517	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on the interaction of its protein product with thyroid hormone receptor beta. This protein is associated with the Golgi apparatus. The N-terminal region of the protein binds Golgi membranes and the C-terminal region binds the minus ends of microtubules; thus, the protein is thought to play a role in assembly and maintenance of the Golgi ribbon structure around the centrosome. Mutations in this gene cause achondrogenesis type IA.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with small size, lung hypoplasia, omphalocele, and ventricular septal defects. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Gene trapped(11) Chemically induced(1)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	C	T	11: 78,273,270	Q40*	probably null	Het
Abcc9	A	G	6: 142,604,828		probably null	Het
Acsm3	C	A	7: 119,775,234	T303N	probably benign	Het
Adamts13	A	T	2: 26,986,591	R506W	probably damaging	Het
Adck5	C	T	15: 76,593,585	T166M	probably damaging	Het
Adcy8	T	A	15: 64,815,417	I413F	probably damaging	Het
Adgrl2	A	T	3: 148,859,175	D252E	probably damaging	Het
Aldh16a1	T	A	7: 45,144,545	T636S	probably benign	Het
Ampd1	C	A	3: 103,090,075	F264L	probably damaging	Het
Arhgap17	T	C	7: 123,286,758		probably benign	Het
Babam2	A	G	5: 32,064,807		probably benign	Het
Bod1l	T	A	5: 41,820,578	E1131V	probably benign	Het
Cbs	C	T	17: 31,613,219	V553M	probably damaging	Het
Cd72	T	C	4: 43,454,475	K18R	probably damaging	Het
Cep89	A	G	7: 35,429,162	Y580C	probably damaging	Het
Chrnb1	T	A	11: 69,792,729	I264F	possibly damaging	Het
Cntf	A	G	19: 12,763,993	W168R	probably damaging	Het
Cxxc1	T	A	18: 74,221,166	D648E	possibly damaging	Het
Cyp2c68	A	T	19: 39,712,492	L294Q	probably damaging	Het
Dab2ip	T	C	2: 35,715,402	S532P	probably damaging	Het
Defb3	G	A	8: 19,295,184	C52Y	probably damaging	Het
Dennd5a	T	G	7: 109,934,221	E114A	probably benign	Het
Dnah12	T	C	14: 26,706,884	F222L	probably benign	Het
Dock9	A	C	14: 121,668,408		probably null	Het
Fras1	A	T	5: 96,645,948	H1043L	probably benign	Het
Gamt	C	A	10: 80,259,907	R63L	possibly damaging	Het
Gm1527	A	G	3: 28,915,395	H298R	probably benign	Het
Gphb5	C	T	12: 75,415,822		probably null	Het
Greb1	A	T	12: 16,733,421	V104D	possibly damaging	Het
Hck	A	G	2: 153,129,076	D86G	probably damaging	Het
Jhy	T	A	9: 40,922,662	K321*	probably null	Het
Kcna5	C	T	6: 126,534,736	R143H	probably damaging	Het
Kif19a	G	T	11: 114,789,438	W867L	possibly damaging	Het
Map3k4	G	A	17: 12,271,416	A376V	probably damaging	Het
Mars	A	T	10: 127,298,045	M661K	probably benign	Het
Mecp2	C	T	X: 74,035,437	V496M	probably damaging	Het
Mfsd2b	A	T	12: 4,867,651	C132S	probably damaging	Het
Mfsd4a	T	C	1: 132,038,928	Y356C	probably damaging	Het
Mif4gd	G	T	11: 115,609,362	A89E	probably benign	Het
Mkln1	A	T	6: 31,490,547	E593D	probably benign	Het
Mlh1	G	T	9: 111,228,495	N749K	possibly damaging	Het
Mrgprb2	T	A	7: 48,551,959	*339C	probably null	Het
Nphp4	T	C	4: 152,547,079	V812A	probably benign	Het
Nrcam	G	T	12: 44,576,771	V1048L	probably benign	Het
Obsl1	G	A	1: 75,493,859	A856V	probably damaging	Het
Osgepl1	T	A	1: 53,318,167	F163I	probably damaging	Het
Pcdha6	C	A	18: 36,969,068	T438K	possibly damaging	Het
Pcdhb20	A	T	18: 37,505,233	M271L	probably benign	Het
Phip	T	C	9: 82,906,952	T770A	probably benign	Het
Ppm1d	A	G	11: 85,326,908	T166A	probably damaging	Het
Ptprf	A	T	4: 118,224,735	I1102K	probably benign	Het
Sbsn	T	C	7: 30,753,267	V569A	possibly damaging	Het
Skida1	T	A	2: 18,046,003		probably benign	Het
Smg1	T	A	7: 118,190,586		probably benign	Het
Sorcs2	A	G	5: 36,229,191	Y168H	probably damaging	Het
Sufu	A	T	19: 46,454,733		probably null	Het
Tbc1d24	A	T	17: 24,185,526	W215R	probably damaging	Het
Tenm4	T	C	7: 96,902,860	L2502P	probably damaging	Het
Tgm4	A	T	9: 123,061,638	E10V	probably damaging	Het
Ttn	C	A	2: 76,709,899	A34248S	possibly damaging	Het
Ube3a	T	A	7: 59,272,028	N49K	probably damaging	Het
Ube3c	A	G	5: 29,658,292	D855G	possibly damaging	Het
Ugt8a	A	G	3: 125,875,553	S301P	probably benign	Het
Wdfy4	T	A	14: 33,102,577	N1295I	possibly damaging	Het
Wdr47	G	T	3: 108,610,012	G43C	probably damaging	Het
Wdtc1	A	C	4: 133,294,362	L601W	unknown	Het
Zfp236	A	G	18: 82,640,151	F614S	possibly damaging	Het
Zfp637	T	A	6: 117,845,086	D58E	possibly damaging	Het

Other mutations in Trip11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Trip11	APN	12	101886147	missense	probably benign	0.37
IGL00484:Trip11	APN	12	101885311	nonsense	probably null
IGL00972:Trip11	APN	12	101894337	missense	probably null	1.00
IGL01476:Trip11	APN	12	101898911	missense	probably damaging	0.96
IGL01591:Trip11	APN	12	101883345	missense	probably damaging	0.98
IGL01667:Trip11	APN	12	101878862	missense	probably damaging	1.00
IGL01764:Trip11	APN	12	101884631	missense	probably damaging	1.00
IGL01789:Trip11	APN	12	101871831	missense	probably benign	0.05
IGL01814:Trip11	APN	12	101884488	missense	probably damaging	0.98
IGL01898:Trip11	APN	12	101885676	missense	probably benign
IGL01924:Trip11	APN	12	101886884	missense	possibly damaging	0.93
IGL02020:Trip11	APN	12	101884313	missense	probably damaging	1.00
IGL02475:Trip11	APN	12	101895683	missense	probably benign	0.01
IGL02544:Trip11	APN	12	101893521	missense	probably damaging	1.00
IGL02678:Trip11	APN	12	101883390	missense	probably damaging	0.96
IGL02714:Trip11	APN	12	101884001	missense	probably damaging	1.00
IGL02718:Trip11	APN	12	101886025	missense	probably benign	0.24
IGL02904:Trip11	APN	12	101886838	missense	probably damaging	1.00
IGL03012:Trip11	APN	12	101883936	missense	probably damaging	1.00
IGL03191:Trip11	APN	12	101898925	missense	probably damaging	1.00
IGL03327:Trip11	APN	12	101883418	missense	possibly damaging	0.87
IGL03337:Trip11	APN	12	101885019	missense	probably damaging	1.00
NA:Trip11	UTSW	12	101894321	unclassified	probably null
R0027:Trip11	UTSW	12	101885169	missense	probably benign	0.00
R0028:Trip11	UTSW	12	101884757	missense	probably damaging	1.00
R0238:Trip11	UTSW	12	101884728	missense	probably damaging	1.00
R0238:Trip11	UTSW	12	101884728	missense	probably damaging	1.00
R0239:Trip11	UTSW	12	101884728	missense	probably damaging	1.00
R0239:Trip11	UTSW	12	101884728	missense	probably damaging	1.00
R0505:Trip11	UTSW	12	101885672	missense	probably damaging	0.98
R0556:Trip11	UTSW	12	101884518	nonsense	probably null
R0573:Trip11	UTSW	12	101886860	missense	probably benign	0.02
R0626:Trip11	UTSW	12	101885976	missense	possibly damaging	0.54
R1519:Trip11	UTSW	12	101886160	missense	probably benign	0.04
R1530:Trip11	UTSW	12	101912767	missense	unknown
R1647:Trip11	UTSW	12	101884392	nonsense	probably null
R1648:Trip11	UTSW	12	101884392	nonsense	probably null
R1856:Trip11	UTSW	12	101883333	nonsense	probably null
R2013:Trip11	UTSW	12	101837722	missense	probably damaging	1.00
R2017:Trip11	UTSW	12	101885360	missense	probably benign	0.00
R2206:Trip11	UTSW	12	101873442	missense	probably benign	0.25
R2207:Trip11	UTSW	12	101873442	missense	probably benign	0.25
R2304:Trip11	UTSW	12	101898977	missense	possibly damaging	0.58
R2328:Trip11	UTSW	12	101878827	makesense	probably null
R2513:Trip11	UTSW	12	101837727	missense	possibly damaging	0.94
R3499:Trip11	UTSW	12	101893694	missense	possibly damaging	0.87
R4105:Trip11	UTSW	12	101894322	nonsense	probably null
R4124:Trip11	UTSW	12	101895698	nonsense	probably null
R4126:Trip11	UTSW	12	101895698	nonsense	probably null
R4128:Trip11	UTSW	12	101895698	nonsense	probably null
R4175:Trip11	UTSW	12	101895698	nonsense	probably null
R4176:Trip11	UTSW	12	101895698	nonsense	probably null
R4181:Trip11	UTSW	12	101893768	missense	probably damaging	1.00
R4296:Trip11	UTSW	12	101885868	nonsense	probably null
R4302:Trip11	UTSW	12	101893768	missense	probably damaging	1.00
R4306:Trip11	UTSW	12	101886939	missense	probably benign
R4342:Trip11	UTSW	12	101884316	missense	probably damaging	1.00
R4576:Trip11	UTSW	12	101886240	nonsense	probably null
R4586:Trip11	UTSW	12	101883341	missense	possibly damaging	0.55
R4634:Trip11	UTSW	12	101837616	missense	probably damaging	1.00
R4696:Trip11	UTSW	12	101885290	missense	possibly damaging	0.71
R4792:Trip11	UTSW	12	101885446	missense	probably benign	0.10
R4903:Trip11	UTSW	12	101886806	critical splice donor site	probably null
R5001:Trip11	UTSW	12	101884910	nonsense	probably null
R5017:Trip11	UTSW	12	101846620	missense	probably benign	0.00
R5227:Trip11	UTSW	12	101884920	missense	probably damaging	1.00
R5231:Trip11	UTSW	12	101885601	missense	probably damaging	0.96
R5539:Trip11	UTSW	12	101885127	missense	probably damaging	0.98
R5754:Trip11	UTSW	12	101885665	nonsense	probably null
R5755:Trip11	UTSW	12	101885665	nonsense	probably null
R5910:Trip11	UTSW	12	101883479	missense	probably damaging	1.00
R6083:Trip11	UTSW	12	101889742	missense	probably benign	0.00
R6208:Trip11	UTSW	12	101898895	missense	probably damaging	1.00
R6216:Trip11	UTSW	12	101890600	missense	probably benign	0.31
R6315:Trip11	UTSW	12	101885578	missense	possibly damaging	0.84
R6413:Trip11	UTSW	12	101885531	missense	probably benign	0.12
R6590:Trip11	UTSW	12	101885451	missense	possibly damaging	0.92
R6690:Trip11	UTSW	12	101885451	missense	possibly damaging	0.92
R6914:Trip11	UTSW	12	101846620	missense	probably benign	0.00
R6938:Trip11	UTSW	12	101837627	missense	probably damaging	0.98
R7015:Trip11	UTSW	12	101893683	missense	probably damaging	1.00
R7023:Trip11	UTSW	12	101885867	missense	probably benign	0.13
R7133:Trip11	UTSW	12	101884070	missense	probably damaging	0.97
R7271:Trip11	UTSW	12	101884352	missense	probably damaging	1.00
R7424:Trip11	UTSW	12	101885198	missense	probably damaging	1.00
R7431:Trip11	UTSW	12	101884019	missense	possibly damaging	0.84
R7472:Trip11	UTSW	12	101885380	missense	probably benign	0.00
R7491:Trip11	UTSW	12	101885435	missense	probably damaging	1.00
R7752:Trip11	UTSW	12	101886974	missense	probably benign	0.01
R7763:Trip11	UTSW	12	101844855	missense	probably benign	0.03
R7779:Trip11	UTSW	12	101883537	missense	probably damaging	0.97
R7844:Trip11	UTSW	12	101878144	missense	probably damaging	1.00
R7927:Trip11	UTSW	12	101878144	missense	probably damaging	1.00
R8055:Trip11	UTSW	12	101837665	missense	probably damaging	1.00
X0020:Trip11	UTSW	12	101885913	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCTGAGATCAAAAGCAACTTGC -3'
(R):5'- AGAACCCATCAGCTTGAGGATG -3'

Sequencing Primer
(F):5'- GCTCTAAATGTTCATTGAGCTGTTC -3'
(R):5'- GGCCCTAAGTGATTTACAG -3'

Posted On

2017-02-15