Incidental Mutation 'R0558:Limch1'
ID45712
Institutional Source Beutler Lab
Gene Symbol Limch1
Ensembl Gene ENSMUSG00000037736
Gene NameLIM and calponin homology domains 1
Synonyms3732412D22Rik
MMRRC Submission 038750-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R0558 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location66745827-67057158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66969155 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 42 (D42G)
Ref Sequence ENSEMBL: ENSMUSP00000123337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038188] [ENSMUST00000101164] [ENSMUST00000117601] [ENSMUST00000118242] [ENSMUST00000122812] [ENSMUST00000127184] [ENSMUST00000132991]
Predicted Effect probably damaging
Transcript: ENSMUST00000038188
AA Change: D33G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043163
Gene: ENSMUSG00000037736
AA Change: D33G

DomainStartEndE-ValueType
low complexity region 41 57 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
coiled coil region 192 241 N/A INTRINSIC
low complexity region 411 430 N/A INTRINSIC
coiled coil region 615 672 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
LIM 830 888 5.08e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101164
AA Change: D189G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098723
Gene: ENSMUSG00000037736
AA Change: D189G

DomainStartEndE-ValueType
CH 23 124 2.09e-13 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
coiled coil region 348 397 N/A INTRINSIC
low complexity region 567 586 N/A INTRINSIC
coiled coil region 771 828 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
LIM 986 1044 5.08e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117601
AA Change: D30G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113544
Gene: ENSMUSG00000037736
AA Change: D30G

DomainStartEndE-ValueType
CH 23 124 1e-15 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
coiled coil region 348 397 N/A INTRINSIC
low complexity region 567 586 N/A INTRINSIC
coiled coil region 704 752 N/A INTRINSIC
low complexity region 759 771 N/A INTRINSIC
LIM 910 968 2.4e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118242
AA Change: D189G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112732
Gene: ENSMUSG00000037736
AA Change: D189G

DomainStartEndE-ValueType
CH 23 124 2.09e-13 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
coiled coil region 336 385 N/A INTRINSIC
low complexity region 555 574 N/A INTRINSIC
coiled coil region 782 839 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
LIM 997 1055 5.08e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119854
AA Change: D189G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112651
Gene: ENSMUSG00000037736
AA Change: D189G

DomainStartEndE-ValueType
CH 23 124 2.09e-13 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
Pfam:DUF4757 250 418 5.2e-66 PFAM
low complexity region 567 586 N/A INTRINSIC
coiled coil region 771 828 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 989 1003 N/A INTRINSIC
LIM 1012 1070 5.08e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122812
Predicted Effect probably damaging
Transcript: ENSMUST00000127184
AA Change: D33G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114681
Gene: ENSMUSG00000037736
AA Change: D33G

DomainStartEndE-ValueType
low complexity region 41 57 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
coiled coil region 180 229 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132991
AA Change: D42G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123337
Gene: ENSMUSG00000037736
AA Change: D42G

DomainStartEndE-ValueType
low complexity region 50 66 N/A INTRINSIC
low complexity region 76 89 N/A INTRINSIC
Pfam:DUF4757 103 269 2.6e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202048
Meta Mutation Damage Score 0.1195 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (80/80)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik T C 17: 25,947,549 N338S probably benign Het
Abcc2 G A 19: 43,800,724 G273R probably benign Het
Adamts10 T C 17: 33,550,609 V935A probably benign Het
Anapc15-ps T C 10: 95,673,121 D90G probably damaging Het
Atic T A 1: 71,563,788 V107E probably benign Het
Atp4b T C 8: 13,393,523 T52A possibly damaging Het
Cacna1h C T 17: 25,381,550 A1606T probably damaging Het
Cacng6 T A 7: 3,434,808 Y217* probably null Het
Cc2d2a T G 5: 43,724,387 probably benign Het
Cd226 T A 18: 89,207,214 H78Q probably benign Het
Cers3 A G 7: 66,783,418 D161G probably damaging Het
Ces1f T C 8: 93,275,389 H37R probably benign Het
Chek1 T A 9: 36,712,115 N421I possibly damaging Het
Cma2 T C 14: 55,972,792 Y45H probably damaging Het
Cmas C A 6: 142,775,244 Y401* probably null Het
Cyp2j8 A T 4: 96,444,634 S492T probably benign Het
Dnah12 T C 14: 26,709,310 S358P probably benign Het
Dnajc13 T C 9: 104,201,952 probably null Het
Ep400 A C 5: 110,685,067 probably benign Het
Fam209 T A 2: 172,472,838 N82K probably benign Het
Fam92a T C 4: 12,164,095 D248G probably damaging Het
G3bp2 A T 5: 92,073,197 Y20N probably damaging Het
Gli2 T C 1: 118,837,649 D924G probably benign Het
Gm10787 T C 10: 77,022,016 noncoding transcript Het
Gm11568 A G 11: 99,858,046 R26G unknown Het
Gm4788 A G 1: 139,739,492 V376A probably damaging Het
Hivep3 T G 4: 120,096,566 L693R probably damaging Het
Hook1 A G 4: 95,993,212 probably benign Het
Ibtk A C 9: 85,737,538 D116E probably damaging Het
Insrr C T 3: 87,810,981 T927I possibly damaging Het
Irx1 T G 13: 71,959,628 S312R probably benign Het
Itga11 T C 9: 62,752,288 Y441H probably benign Het
Itsn1 A G 16: 91,899,623 D38G possibly damaging Het
Kat6b G T 14: 21,669,421 E1280D probably benign Het
Kcnk10 T A 12: 98,436,301 Y293F possibly damaging Het
Krt74 T A 15: 101,760,963 noncoding transcript Het
Lars T G 18: 42,214,837 I974L probably benign Het
Mau2 G C 8: 70,042,432 T85R probably damaging Het
Mkrn3 A G 7: 62,418,864 I393T probably benign Het
Mpl A C 4: 118,444,020 S541R probably damaging Het
Nfrkb T C 9: 31,410,268 S754P possibly damaging Het
Olfr1170 A G 2: 88,224,474 V186A possibly damaging Het
Olfr1233 A G 2: 89,340,236 L22P probably benign Het
Olfr1350 T C 7: 6,570,653 Y221H possibly damaging Het
Olfr1537 T A 9: 39,238,200 T75S probably damaging Het
P2rx7 A T 5: 122,673,798 I391F possibly damaging Het
Pbrm1 T A 14: 31,085,059 probably null Het
Pcdh8 T C 14: 79,770,076 D349G probably damaging Het
Pias1 A G 9: 62,882,009 S639P possibly damaging Het
Pkhd1l1 A T 15: 44,484,424 I232F probably damaging Het
Plxnc1 C T 10: 94,837,935 R995Q probably damaging Het
Pnliprp2 T A 19: 58,774,087 S375T probably benign Het
Prkar1b C T 5: 139,020,092 V313M probably benign Het
Ptpn13 T C 5: 103,529,717 S734P probably damaging Het
Rdh1 T C 10: 127,759,941 W2R possibly damaging Het
Rsph10b A T 5: 143,949,338 I285L probably benign Het
Rubcnl T C 14: 75,047,547 F502S probably damaging Het
Ryr2 T A 13: 11,638,443 I3693F probably damaging Het
Ryr2 T C 13: 11,799,861 Y675C probably damaging Het
Scaper T C 9: 55,685,923 T477A probably benign Het
Scn2a G T 2: 65,711,925 V791L probably benign Het
Sdk1 A T 5: 142,132,065 T1573S probably damaging Het
Sema3c A T 5: 17,714,415 H483L probably benign Het
Sema6c T C 3: 95,168,691 S219P probably damaging Het
Slc10a5 T G 3: 10,335,117 E161A probably damaging Het
Slc22a23 C T 13: 34,344,383 G139S possibly damaging Het
Slc34a3 C T 2: 25,233,065 probably benign Het
Slc38a9 A T 13: 112,729,196 probably null Het
Taok1 A C 11: 77,559,844 S367R possibly damaging Het
Tlr6 G A 5: 64,954,860 Q235* probably null Het
Top2a A G 11: 98,996,839 V1281A probably benign Het
Tpgs1 T C 10: 79,675,782 Y253H probably damaging Het
Tubgcp3 T C 8: 12,653,462 T288A probably benign Het
Ubr4 A G 4: 139,426,902 E2140G probably benign Het
Uso1 A G 5: 92,174,019 Q257R probably benign Het
Zfp106 A G 2: 120,532,196 V48A probably damaging Het
Zfp174 T A 16: 3,848,254 S128T possibly damaging Het
Zscan26 T A 13: 21,445,055 D426V probably benign Het
Other mutations in Limch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Limch1 APN 5 66953679 missense probably damaging 0.99
IGL00644:Limch1 APN 5 67016552 missense probably benign 0.01
IGL00705:Limch1 APN 5 66993153 nonsense probably null
IGL01154:Limch1 APN 5 66745958 nonsense probably null 0.00
IGL01865:Limch1 APN 5 66974580 nonsense probably null
IGL02529:Limch1 APN 5 67002613 missense possibly damaging 0.89
IGL03171:Limch1 APN 5 67034194 missense possibly damaging 0.80
IGL03308:Limch1 APN 5 67002558 missense possibly damaging 0.92
IGL03396:Limch1 APN 5 66953673 missense probably damaging 1.00
R0067:Limch1 UTSW 5 66974622 missense probably damaging 0.99
R0067:Limch1 UTSW 5 66974622 missense probably damaging 0.99
R0114:Limch1 UTSW 5 67036084 intron probably benign
R0129:Limch1 UTSW 5 66959590 missense probably damaging 0.96
R0193:Limch1 UTSW 5 67027539 missense probably damaging 1.00
R0194:Limch1 UTSW 5 66999273 missense probably benign 0.05
R0367:Limch1 UTSW 5 66857954 critical splice donor site probably null
R0927:Limch1 UTSW 5 66997233 missense probably damaging 1.00
R1190:Limch1 UTSW 5 66969197 missense probably damaging 1.00
R1316:Limch1 UTSW 5 66999243 missense probably damaging 1.00
R1469:Limch1 UTSW 5 66881980 splice site probably benign
R1647:Limch1 UTSW 5 66999256 missense probably damaging 1.00
R1648:Limch1 UTSW 5 66999256 missense probably damaging 1.00
R1944:Limch1 UTSW 5 66999099 missense probably damaging 1.00
R2103:Limch1 UTSW 5 66998729 missense probably benign 0.05
R2126:Limch1 UTSW 5 67029760 missense probably damaging 1.00
R2248:Limch1 UTSW 5 67044399 missense probably damaging 1.00
R2415:Limch1 UTSW 5 66974634 missense probably damaging 1.00
R3762:Limch1 UTSW 5 67028840 missense probably damaging 1.00
R3797:Limch1 UTSW 5 66969079 missense probably damaging 1.00
R4659:Limch1 UTSW 5 67027557 missense probably damaging 1.00
R4773:Limch1 UTSW 5 67027507 missense probably damaging 0.99
R4876:Limch1 UTSW 5 66881927 missense possibly damaging 0.64
R5062:Limch1 UTSW 5 66969235 missense probably damaging 1.00
R5191:Limch1 UTSW 5 67027561 missense probably damaging 1.00
R5202:Limch1 UTSW 5 66993173 missense probably damaging 1.00
R5335:Limch1 UTSW 5 66881957 missense probably damaging 1.00
R5436:Limch1 UTSW 5 66974566 missense possibly damaging 0.72
R5994:Limch1 UTSW 5 66974622 missense probably damaging 1.00
R6049:Limch1 UTSW 5 67030860 missense probably benign 0.32
R6228:Limch1 UTSW 5 67016502 missense probably damaging 1.00
R6547:Limch1 UTSW 5 67028774 missense probably damaging 1.00
R6600:Limch1 UTSW 5 66745938 missense probably benign
R6888:Limch1 UTSW 5 67021926 missense probably benign 0.21
R7111:Limch1 UTSW 5 67025176 intron probably null
R7132:Limch1 UTSW 5 66953685 missense probably damaging 1.00
R7144:Limch1 UTSW 5 67017658 missense probably benign 0.10
R7302:Limch1 UTSW 5 66959599 missense probably benign 0.02
R7341:Limch1 UTSW 5 67034202 missense probably benign 0.06
R7491:Limch1 UTSW 5 67054237 missense probably damaging 0.99
X0022:Limch1 UTSW 5 67021952 missense probably benign 0.00
X0027:Limch1 UTSW 5 67002620 missense probably damaging 1.00
Z1177:Limch1 UTSW 5 67028799 missense not run
Predicted Primers PCR Primer
(F):5'- TTTCCACACAGATCCTCCATGCAAG -3'
(R):5'- TAGAATTACCAGGCTCCAGCCAGG -3'

Sequencing Primer
(F):5'- GATCCTCCATGCAAGTGTCTTTG -3'
(R):5'- GAGTTTGCCTTTCCAAGGAC -3'
Posted On2013-06-11