Incidental Mutation 'R5890:Dock9'
ID 457122
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Name dedicator of cytokinesis 9
Synonyms D14Wsu89e, B230309H04Rik, Zizimin1
MMRRC Submission 044091-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5890 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 121779458-122035249 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 121905820 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212181] [ENSMUST00000212376]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000040700
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000040700
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000100299
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000100299
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000212181
Predicted Effect probably null
Transcript: ENSMUST00000212181
Predicted Effect probably null
Transcript: ENSMUST00000212376
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,550,554 (GRCm39) probably null Het
Acsm3 C A 7: 119,374,457 (GRCm39) T303N probably benign Het
Adamts13 A T 2: 26,876,603 (GRCm39) R506W probably damaging Het
Adck5 C T 15: 76,477,785 (GRCm39) T166M probably damaging Het
Adcy8 T A 15: 64,687,266 (GRCm39) I413F probably damaging Het
Adgrl2 A T 3: 148,564,811 (GRCm39) D252E probably damaging Het
Aldh16a1 T A 7: 44,793,969 (GRCm39) T636S probably benign Het
Ampd1 C A 3: 102,997,391 (GRCm39) F264L probably damaging Het
Arhgap17 T C 7: 122,885,981 (GRCm39) probably benign Het
Babam2 A G 5: 32,222,151 (GRCm39) probably benign Het
Bltp2 C T 11: 78,164,096 (GRCm39) Q40* probably null Het
Bod1l T A 5: 41,977,921 (GRCm39) E1131V probably benign Het
Cbs C T 17: 31,832,193 (GRCm39) V553M probably damaging Het
Cd72 T C 4: 43,454,475 (GRCm39) K18R probably damaging Het
Cep89 A G 7: 35,128,587 (GRCm39) Y580C probably damaging Het
Chrnb1 T A 11: 69,683,555 (GRCm39) I264F possibly damaging Het
Cntf A G 19: 12,741,357 (GRCm39) W168R probably damaging Het
Cxxc1 T A 18: 74,354,237 (GRCm39) D648E possibly damaging Het
Cyp2c68 A T 19: 39,700,936 (GRCm39) L294Q probably damaging Het
Dab2ip T C 2: 35,605,414 (GRCm39) S532P probably damaging Het
Defb3 G A 8: 19,345,200 (GRCm39) C52Y probably damaging Het
Dennd5a T G 7: 109,533,428 (GRCm39) E114A probably benign Het
Dnah12 T C 14: 26,428,039 (GRCm39) F222L probably benign Het
Fras1 A T 5: 96,793,807 (GRCm39) H1043L probably benign Het
Gamt C A 10: 80,095,741 (GRCm39) R63L possibly damaging Het
Gm1527 A G 3: 28,969,544 (GRCm39) H298R probably benign Het
Gphb5 C T 12: 75,462,596 (GRCm39) probably null Het
Greb1 A T 12: 16,783,422 (GRCm39) V104D possibly damaging Het
Hck A G 2: 152,970,996 (GRCm39) D86G probably damaging Het
Jhy T A 9: 40,833,958 (GRCm39) K321* probably null Het
Kcna5 C T 6: 126,511,699 (GRCm39) R143H probably damaging Het
Kif19a G T 11: 114,680,264 (GRCm39) W867L possibly damaging Het
Map3k4 G A 17: 12,490,303 (GRCm39) A376V probably damaging Het
Mars1 A T 10: 127,133,914 (GRCm39) M661K probably benign Het
Mecp2 C T X: 73,079,043 (GRCm39) V496M probably damaging Het
Mfsd2b A T 12: 4,917,651 (GRCm39) C132S probably damaging Het
Mfsd4a T C 1: 131,966,666 (GRCm39) Y356C probably damaging Het
Mif4gd G T 11: 115,500,188 (GRCm39) A89E probably benign Het
Mkln1 A T 6: 31,467,482 (GRCm39) E593D probably benign Het
Mlh1 G T 9: 111,057,563 (GRCm39) N749K possibly damaging Het
Mrgprb2 T A 7: 48,201,707 (GRCm39) *339C probably null Het
Nphp4 T C 4: 152,631,536 (GRCm39) V812A probably benign Het
Nrcam G T 12: 44,623,554 (GRCm39) V1048L probably benign Het
Obsl1 G A 1: 75,470,503 (GRCm39) A856V probably damaging Het
Osgepl1 T A 1: 53,357,326 (GRCm39) F163I probably damaging Het
Pcdha6 C A 18: 37,102,121 (GRCm39) T438K possibly damaging Het
Pcdhb20 A T 18: 37,638,286 (GRCm39) M271L probably benign Het
Phip T C 9: 82,789,005 (GRCm39) T770A probably benign Het
Ppm1d A G 11: 85,217,734 (GRCm39) T166A probably damaging Het
Ptprf A T 4: 118,081,932 (GRCm39) I1102K probably benign Het
Sbsn T C 7: 30,452,692 (GRCm39) V569A possibly damaging Het
Skida1 T A 2: 18,050,814 (GRCm39) probably benign Het
Smg1 T A 7: 117,789,809 (GRCm39) probably benign Het
Sorcs2 A G 5: 36,386,535 (GRCm39) Y168H probably damaging Het
Sufu A T 19: 46,443,172 (GRCm39) probably null Het
Tbc1d24 A T 17: 24,404,500 (GRCm39) W215R probably damaging Het
Tenm4 T C 7: 96,552,067 (GRCm39) L2502P probably damaging Het
Tgm4 A T 9: 122,890,703 (GRCm39) E10V probably damaging Het
Trip11 T C 12: 101,852,231 (GRCm39) E611G probably damaging Het
Ttn C A 2: 76,540,243 (GRCm39) A34248S possibly damaging Het
Ube3a T A 7: 58,921,776 (GRCm39) N49K probably damaging Het
Ube3c A G 5: 29,863,290 (GRCm39) D855G possibly damaging Het
Ugt8a A G 3: 125,669,202 (GRCm39) S301P probably benign Het
Wdfy4 T A 14: 32,824,534 (GRCm39) N1295I possibly damaging Het
Wdr47 G T 3: 108,517,328 (GRCm39) G43C probably damaging Het
Wdtc1 A C 4: 133,021,673 (GRCm39) L601W unknown Het
Zfp236 A G 18: 82,658,276 (GRCm39) F614S possibly damaging Het
Zfp637 T A 6: 117,822,047 (GRCm39) D58E possibly damaging Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121,905,880 (GRCm39) missense probably benign 0.12
IGL00817:Dock9 APN 14 121,935,703 (GRCm39) missense probably damaging 0.96
IGL00923:Dock9 APN 14 121,844,504 (GRCm39) unclassified probably benign
IGL01385:Dock9 APN 14 121,817,995 (GRCm39) missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121,890,496 (GRCm39) missense probably damaging 1.00
IGL01767:Dock9 APN 14 121,860,282 (GRCm39) missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121,796,440 (GRCm39) missense probably damaging 1.00
IGL02512:Dock9 APN 14 121,856,950 (GRCm39) splice site probably benign
IGL02525:Dock9 APN 14 121,877,538 (GRCm39) missense probably damaging 1.00
IGL02550:Dock9 APN 14 121,935,724 (GRCm39) start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121,862,559 (GRCm39) splice site probably benign
IGL02666:Dock9 APN 14 121,818,111 (GRCm39) missense probably benign 0.42
IGL02674:Dock9 APN 14 121,833,023 (GRCm39) splice site probably null
IGL02795:Dock9 APN 14 121,877,390 (GRCm39) missense probably benign 0.04
IGL03074:Dock9 APN 14 121,844,682 (GRCm39) missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121,876,940 (GRCm39) missense probably damaging 1.00
IGL03294:Dock9 APN 14 121,879,035 (GRCm39) splice site probably benign
R0036:Dock9 UTSW 14 121,860,265 (GRCm39) missense probably damaging 1.00
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0270:Dock9 UTSW 14 121,813,411 (GRCm39) missense probably benign 0.02
R0494:Dock9 UTSW 14 121,899,996 (GRCm39) missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121,889,180 (GRCm39) nonsense probably null
R1029:Dock9 UTSW 14 121,837,096 (GRCm39) splice site probably null
R1214:Dock9 UTSW 14 121,823,728 (GRCm39) missense probably benign 0.02
R1231:Dock9 UTSW 14 121,813,362 (GRCm39) missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121,783,476 (GRCm39) missense probably damaging 1.00
R1629:Dock9 UTSW 14 121,780,986 (GRCm39) missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121,889,187 (GRCm39) missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121,864,292 (GRCm39) missense probably benign 0.01
R1772:Dock9 UTSW 14 121,847,210 (GRCm39) missense probably benign 0.07
R1855:Dock9 UTSW 14 121,877,571 (GRCm39) missense probably damaging 1.00
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1901:Dock9 UTSW 14 121,862,565 (GRCm39) splice site probably null
R1920:Dock9 UTSW 14 121,820,792 (GRCm39) missense probably damaging 1.00
R1987:Dock9 UTSW 14 121,829,242 (GRCm39) missense probably benign 0.00
R3035:Dock9 UTSW 14 121,844,249 (GRCm39) missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121,866,498 (GRCm39) splice site probably null
R4020:Dock9 UTSW 14 121,844,267 (GRCm39) missense probably benign 0.00
R4021:Dock9 UTSW 14 121,864,324 (GRCm39) missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121,820,883 (GRCm39) missense probably damaging 1.00
R4258:Dock9 UTSW 14 121,818,854 (GRCm39) missense probably benign 0.00
R4423:Dock9 UTSW 14 121,799,465 (GRCm39) critical splice donor site probably null
R4561:Dock9 UTSW 14 121,796,419 (GRCm39) missense probably benign 0.01
R4604:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R4646:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4647:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4776:Dock9 UTSW 14 121,847,509 (GRCm39) missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121,784,008 (GRCm39) missense probably benign 0.37
R4865:Dock9 UTSW 14 121,780,917 (GRCm39) makesense probably null
R4951:Dock9 UTSW 14 121,890,547 (GRCm39) missense probably benign 0.35
R5151:Dock9 UTSW 14 121,815,582 (GRCm39) missense probably damaging 1.00
R5359:Dock9 UTSW 14 121,890,472 (GRCm39) missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121,815,615 (GRCm39) missense probably damaging 1.00
R5502:Dock9 UTSW 14 121,847,594 (GRCm39) splice site probably null
R5579:Dock9 UTSW 14 121,837,107 (GRCm39) missense probably damaging 1.00
R5753:Dock9 UTSW 14 121,872,037 (GRCm39) missense probably benign 0.05
R5836:Dock9 UTSW 14 121,918,763 (GRCm39) missense probably damaging 1.00
R5858:Dock9 UTSW 14 121,866,204 (GRCm39) missense probably benign 0.00
R6075:Dock9 UTSW 14 121,783,385 (GRCm39) missense probably benign
R6298:Dock9 UTSW 14 121,872,006 (GRCm39) missense probably damaging 1.00
R6306:Dock9 UTSW 14 121,799,492 (GRCm39) missense probably damaging 1.00
R6321:Dock9 UTSW 14 121,783,433 (GRCm39) missense probably damaging 1.00
R6330:Dock9 UTSW 14 121,842,655 (GRCm39) start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121,847,439 (GRCm39) missense probably damaging 1.00
R6784:Dock9 UTSW 14 121,780,926 (GRCm39) missense probably damaging 1.00
R6826:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6830:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6838:Dock9 UTSW 14 121,784,008 (GRCm39) missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121,823,676 (GRCm39) missense probably benign 0.37
R6919:Dock9 UTSW 14 121,880,564 (GRCm39) missense probably benign 0.42
R6989:Dock9 UTSW 14 121,864,791 (GRCm39) missense probably damaging 1.00
R7539:Dock9 UTSW 14 121,818,848 (GRCm39) missense probably damaging 1.00
R7645:Dock9 UTSW 14 121,835,075 (GRCm39) missense probably benign 0.44
R7875:Dock9 UTSW 14 121,863,396 (GRCm39) nonsense probably null
R7900:Dock9 UTSW 14 121,783,491 (GRCm39) missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121,889,206 (GRCm39) missense probably benign 0.06
R8420:Dock9 UTSW 14 121,783,454 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,918,847 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,864,801 (GRCm39) missense probably benign 0.40
R8514:Dock9 UTSW 14 121,896,199 (GRCm39) missense probably benign 0.25
R8691:Dock9 UTSW 14 121,877,517 (GRCm39) missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121,842,595 (GRCm39) missense probably damaging 0.98
R8894:Dock9 UTSW 14 121,860,373 (GRCm39) missense probably benign 0.10
R8900:Dock9 UTSW 14 121,817,940 (GRCm39) missense probably damaging 1.00
R9069:Dock9 UTSW 14 121,866,324 (GRCm39) missense probably damaging 0.98
R9218:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R9233:Dock9 UTSW 14 121,820,781 (GRCm39) missense probably benign 0.09
R9236:Dock9 UTSW 14 121,876,970 (GRCm39) missense probably damaging 1.00
R9285:Dock9 UTSW 14 121,833,012 (GRCm39) missense probably benign
R9451:Dock9 UTSW 14 121,787,601 (GRCm39) splice site probably benign
R9461:Dock9 UTSW 14 121,842,601 (GRCm39) missense probably benign 0.05
R9484:Dock9 UTSW 14 121,818,844 (GRCm39) missense probably damaging 1.00
R9517:Dock9 UTSW 14 121,829,236 (GRCm39) missense probably benign 0.07
R9542:Dock9 UTSW 14 121,864,775 (GRCm39) missense probably damaging 1.00
R9694:Dock9 UTSW 14 121,818,791 (GRCm39) missense probably damaging 1.00
R9701:Dock9 UTSW 14 121,876,983 (GRCm39) missense probably benign 0.01
R9703:Dock9 UTSW 14 121,781,989 (GRCm39) makesense probably null
R9726:Dock9 UTSW 14 121,835,149 (GRCm39) missense possibly damaging 0.61
R9741:Dock9 UTSW 14 121,877,516 (GRCm39) missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121,792,687 (GRCm39) missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121,889,194 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTCTGGAGACATTGATATTCGAG -3'
(R):5'- TCCTCACCTGCAGATGTCTG -3'

Sequencing Primer
(F):5'- GGAGACATTGATATTCGAGAATTACG -3'
(R):5'- CAGATGTCTGGAGGGACTTC -3'
Posted On 2017-02-15