Incidental Mutation 'R5890:Tbc1d24'
ID457127
Institutional Source Beutler Lab
Gene Symbol Tbc1d24
Ensembl Gene ENSMUSG00000036473
Gene NameTBC1 domain family, member 24
Synonyms
MMRRC Submission 044091-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5890 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24175431-24209387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24185526 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 215 (W215R)
Ref Sequence ENSEMBL: ENSMUSP00000144462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040474] [ENSMUST00000097376] [ENSMUST00000167791] [ENSMUST00000168378] [ENSMUST00000168410] [ENSMUST00000171189] [ENSMUST00000201089] [ENSMUST00000201301] [ENSMUST00000201359] [ENSMUST00000201583] [ENSMUST00000201805] [ENSMUST00000201960] [ENSMUST00000202853] [ENSMUST00000202925]
Predicted Effect probably damaging
Transcript: ENSMUST00000040474
AA Change: W215R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036458
Gene: ENSMUSG00000036473
AA Change: W215R

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097376
AA Change: W215R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000094989
Gene: ENSMUSG00000036473
AA Change: W215R

DomainStartEndE-ValueType
TBC 42 259 8.8e-6 SMART
TLDc 342 556 7.8e-82 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167791
AA Change: W215R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127005
Gene: ENSMUSG00000036473
AA Change: W215R

DomainStartEndE-ValueType
TBC 42 259 8.6e-6 SMART
TLDc 342 556 7.6e-82 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168378
AA Change: W215R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126107
Gene: ENSMUSG00000036473
AA Change: W215R

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168410
AA Change: W215R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128868
Gene: ENSMUSG00000036473
AA Change: W215R

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171189
AA Change: W215R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128001
Gene: ENSMUSG00000036473
AA Change: W215R

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201089
AA Change: W215R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144250
Gene: ENSMUSG00000036473
AA Change: W215R

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201301
AA Change: W215R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143949
Gene: ENSMUSG00000036473
AA Change: W215R

DomainStartEndE-ValueType
TBC 42 259 8.8e-6 SMART
TLDc 342 556 7.8e-82 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201359
AA Change: W215R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144026
Gene: ENSMUSG00000036473
AA Change: W215R

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
Blast:TLDc 283 321 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000201583
SMART Domains Protein: ENSMUSP00000144097
Gene: ENSMUSG00000036473

DomainStartEndE-ValueType
TLDc 1 182 5.2e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201716
Predicted Effect probably damaging
Transcript: ENSMUST00000201805
AA Change: W215R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143883
Gene: ENSMUSG00000036473
AA Change: W215R

DomainStartEndE-ValueType
TBC 42 259 8.8e-6 SMART
TLDc 342 556 7.8e-82 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201960
AA Change: W215R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144208
Gene: ENSMUSG00000036473
AA Change: W215R

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202018
Predicted Effect probably damaging
Transcript: ENSMUST00000202853
AA Change: W215R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144462
Gene: ENSMUSG00000107169
AA Change: W215R

DomainStartEndE-ValueType
TBC 42 259 8.8e-6 SMART
Blast:TLDc 283 321 4e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000202925
AA Change: W215R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144575
Gene: ENSMUSG00000036473
AA Change: W215R

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a conserved domain, referred to as the TBC domain, characteristic of proteins which interact with GTPases. TBC domain proteins may serve as GTPase-activating proteins for a particular group of GTPases, the Rab (Ras-related proteins in brain) small GTPases which are involved in the regulation of membrane trafficking. Mutations in this gene are associated with familial infantile myoclonic epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik C T 11: 78,273,270 Q40* probably null Het
Abcc9 A G 6: 142,604,828 probably null Het
Acsm3 C A 7: 119,775,234 T303N probably benign Het
Adamts13 A T 2: 26,986,591 R506W probably damaging Het
Adck5 C T 15: 76,593,585 T166M probably damaging Het
Adcy8 T A 15: 64,815,417 I413F probably damaging Het
Adgrl2 A T 3: 148,859,175 D252E probably damaging Het
Aldh16a1 T A 7: 45,144,545 T636S probably benign Het
Ampd1 C A 3: 103,090,075 F264L probably damaging Het
Arhgap17 T C 7: 123,286,758 probably benign Het
Babam2 A G 5: 32,064,807 probably benign Het
Bod1l T A 5: 41,820,578 E1131V probably benign Het
Cbs C T 17: 31,613,219 V553M probably damaging Het
Cd72 T C 4: 43,454,475 K18R probably damaging Het
Cep89 A G 7: 35,429,162 Y580C probably damaging Het
Chrnb1 T A 11: 69,792,729 I264F possibly damaging Het
Cntf A G 19: 12,763,993 W168R probably damaging Het
Cxxc1 T A 18: 74,221,166 D648E possibly damaging Het
Cyp2c68 A T 19: 39,712,492 L294Q probably damaging Het
Dab2ip T C 2: 35,715,402 S532P probably damaging Het
Defb3 G A 8: 19,295,184 C52Y probably damaging Het
Dennd5a T G 7: 109,934,221 E114A probably benign Het
Dnah12 T C 14: 26,706,884 F222L probably benign Het
Dock9 A C 14: 121,668,408 probably null Het
Fras1 A T 5: 96,645,948 H1043L probably benign Het
Gamt C A 10: 80,259,907 R63L possibly damaging Het
Gm1527 A G 3: 28,915,395 H298R probably benign Het
Gphb5 C T 12: 75,415,822 probably null Het
Greb1 A T 12: 16,733,421 V104D possibly damaging Het
Hck A G 2: 153,129,076 D86G probably damaging Het
Jhy T A 9: 40,922,662 K321* probably null Het
Kcna5 C T 6: 126,534,736 R143H probably damaging Het
Kif19a G T 11: 114,789,438 W867L possibly damaging Het
Map3k4 G A 17: 12,271,416 A376V probably damaging Het
Mars A T 10: 127,298,045 M661K probably benign Het
Mecp2 C T X: 74,035,437 V496M probably damaging Het
Mfsd2b A T 12: 4,867,651 C132S probably damaging Het
Mfsd4a T C 1: 132,038,928 Y356C probably damaging Het
Mif4gd G T 11: 115,609,362 A89E probably benign Het
Mkln1 A T 6: 31,490,547 E593D probably benign Het
Mlh1 G T 9: 111,228,495 N749K possibly damaging Het
Mrgprb2 T A 7: 48,551,959 *339C probably null Het
Nphp4 T C 4: 152,547,079 V812A probably benign Het
Nrcam G T 12: 44,576,771 V1048L probably benign Het
Obsl1 G A 1: 75,493,859 A856V probably damaging Het
Osgepl1 T A 1: 53,318,167 F163I probably damaging Het
Pcdha6 C A 18: 36,969,068 T438K possibly damaging Het
Pcdhb20 A T 18: 37,505,233 M271L probably benign Het
Phip T C 9: 82,906,952 T770A probably benign Het
Ppm1d A G 11: 85,326,908 T166A probably damaging Het
Ptprf A T 4: 118,224,735 I1102K probably benign Het
Sbsn T C 7: 30,753,267 V569A possibly damaging Het
Skida1 T A 2: 18,046,003 probably benign Het
Smg1 T A 7: 118,190,586 probably benign Het
Sorcs2 A G 5: 36,229,191 Y168H probably damaging Het
Sufu A T 19: 46,454,733 probably null Het
Tenm4 T C 7: 96,902,860 L2502P probably damaging Het
Tgm4 A T 9: 123,061,638 E10V probably damaging Het
Trip11 T C 12: 101,885,972 E611G probably damaging Het
Ttn C A 2: 76,709,899 A34248S possibly damaging Het
Ube3a T A 7: 59,272,028 N49K probably damaging Het
Ube3c A G 5: 29,658,292 D855G possibly damaging Het
Ugt8a A G 3: 125,875,553 S301P probably benign Het
Wdfy4 T A 14: 33,102,577 N1295I possibly damaging Het
Wdr47 G T 3: 108,610,012 G43C probably damaging Het
Wdtc1 A C 4: 133,294,362 L601W unknown Het
Zfp236 A G 18: 82,640,151 F614S possibly damaging Het
Zfp637 T A 6: 117,845,086 D58E possibly damaging Het
Other mutations in Tbc1d24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Tbc1d24 APN 17 24185828 missense probably damaging 1.00
IGL01511:Tbc1d24 APN 17 24181918 missense probably benign 0.00
IGL02499:Tbc1d24 APN 17 24207619 unclassified probably null
IGL02706:Tbc1d24 APN 17 24185421 missense probably benign 0.32
R1464:Tbc1d24 UTSW 17 24181223 critical splice donor site probably null
R1464:Tbc1d24 UTSW 17 24181223 critical splice donor site probably null
R1529:Tbc1d24 UTSW 17 24185979 missense probably damaging 1.00
R1985:Tbc1d24 UTSW 17 24207964 nonsense probably null
R1987:Tbc1d24 UTSW 17 24206872 missense possibly damaging 0.94
R2425:Tbc1d24 UTSW 17 24186008 missense probably damaging 0.99
R2902:Tbc1d24 UTSW 17 24207246 missense probably benign 0.01
R4622:Tbc1d24 UTSW 17 24208891 missense probably benign 0.03
R4946:Tbc1d24 UTSW 17 24208536 missense possibly damaging 0.94
R5428:Tbc1d24 UTSW 17 24181772 missense probably benign 0.34
R5991:Tbc1d24 UTSW 17 24209069 unclassified probably benign
R6002:Tbc1d24 UTSW 17 24183787 start codon destroyed probably null 1.00
R6145:Tbc1d24 UTSW 17 24208229 missense probably damaging 1.00
R6245:Tbc1d24 UTSW 17 24185993 missense probably damaging 1.00
R6399:Tbc1d24 UTSW 17 24208329 missense probably damaging 0.97
R6764:Tbc1d24 UTSW 17 24185780 missense possibly damaging 0.95
R6893:Tbc1d24 UTSW 17 24182518 missense probably damaging 1.00
R7219:Tbc1d24 UTSW 17 24185292 missense probably damaging 1.00
R7262:Tbc1d24 UTSW 17 24207846 missense probably damaging 1.00
R7490:Tbc1d24 UTSW 17 24182520 missense probably damaging 1.00
R8013:Tbc1d24 UTSW 17 24182821 missense possibly damaging 0.64
R8014:Tbc1d24 UTSW 17 24182821 missense possibly damaging 0.64
Z1176:Tbc1d24 UTSW 17 24206806 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCCTTCTCTAGTAGTTTCTCAGGG -3'
(R):5'- GCCGCATCTTATCCTGCAATG -3'

Sequencing Primer
(F):5'- GTCCTTGACAAACATTCGGATGTC -3'
(R):5'- TTATCCTGCAATGACCCCAC -3'
Posted On2017-02-15