Incidental Mutation 'R5890:Mecp2'
ID457139
Institutional Source Beutler Lab
Gene Symbol Mecp2
Ensembl Gene ENSMUSG00000031393
Gene Namemethyl CpG binding protein 2
Synonyms1500041B07Rik, D630021H01Rik, WBP10, Mbd5
MMRRC Submission 044091-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.600) question?
Stock #R5890 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location74026592-74135363 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74035437 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 496 (V496M)
Ref Sequence ENSEMBL: ENSMUSP00000033770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033770] [ENSMUST00000100750] [ENSMUST00000123362] [ENSMUST00000140399] [ENSMUST00000170481]
Predicted Effect probably damaging
Transcript: ENSMUST00000033770
AA Change: V496M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033770
Gene: ENSMUSG00000031393
AA Change: V496M

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 40 61 N/A INTRINSIC
low complexity region 82 98 N/A INTRINSIC
MBD 109 186 7.34e-36 SMART
AT_hook 202 214 5.16e0 SMART
low complexity region 248 255 N/A INTRINSIC
AT_hook 282 294 1.2e2 SMART
low complexity region 357 420 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100750
AA Change: V479M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000098314
Gene: ENSMUSG00000031393
AA Change: V479M

DomainStartEndE-ValueType
low complexity region 23 44 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
MBD 92 169 7.34e-36 SMART
AT_hook 185 197 5.16e0 SMART
low complexity region 231 238 N/A INTRINSIC
AT_hook 265 277 1.2e2 SMART
low complexity region 340 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123362
SMART Domains Protein: ENSMUSP00000118842
Gene: ENSMUSG00000031393

DomainStartEndE-ValueType
low complexity region 23 44 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
MBD 92 166 1.19e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140399
SMART Domains Protein: ENSMUSP00000119947
Gene: ENSMUSG00000031393

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 40 61 N/A INTRINSIC
low complexity region 82 98 N/A INTRINSIC
MBD 109 183 1.19e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170481
AA Change: V479M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127115
Gene: ENSMUSG00000031393
AA Change: V479M

DomainStartEndE-ValueType
low complexity region 23 44 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
MBD 92 169 7.34e-36 SMART
AT_hook 185 197 5.16e0 SMART
low complexity region 231 238 N/A INTRINSIC
AT_hook 265 277 1.2e2 SMART
low complexity region 340 403 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of mental retardation in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
PHENOTYPE: Female mice homozygous or male mice hemizygous for a null allele exhibit premature death, behavioral and neurological abnormalities, abnormal nervous system phenotypes, abnormal breathing, and abnormal hearing. Heterozygous mice exhibit similar behavioral and neurological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik C T 11: 78,273,270 Q40* probably null Het
Abcc9 A G 6: 142,604,828 probably null Het
Acsm3 C A 7: 119,775,234 T303N probably benign Het
Adamts13 A T 2: 26,986,591 R506W probably damaging Het
Adck5 C T 15: 76,593,585 T166M probably damaging Het
Adcy8 T A 15: 64,815,417 I413F probably damaging Het
Adgrl2 A T 3: 148,859,175 D252E probably damaging Het
Aldh16a1 T A 7: 45,144,545 T636S probably benign Het
Ampd1 C A 3: 103,090,075 F264L probably damaging Het
Arhgap17 T C 7: 123,286,758 probably benign Het
Babam2 A G 5: 32,064,807 probably benign Het
Bod1l T A 5: 41,820,578 E1131V probably benign Het
Cbs C T 17: 31,613,219 V553M probably damaging Het
Cd72 T C 4: 43,454,475 K18R probably damaging Het
Cep89 A G 7: 35,429,162 Y580C probably damaging Het
Chrnb1 T A 11: 69,792,729 I264F possibly damaging Het
Cntf A G 19: 12,763,993 W168R probably damaging Het
Cxxc1 T A 18: 74,221,166 D648E possibly damaging Het
Cyp2c68 A T 19: 39,712,492 L294Q probably damaging Het
Dab2ip T C 2: 35,715,402 S532P probably damaging Het
Defb3 G A 8: 19,295,184 C52Y probably damaging Het
Dennd5a T G 7: 109,934,221 E114A probably benign Het
Dnah12 T C 14: 26,706,884 F222L probably benign Het
Dock9 A C 14: 121,668,408 probably null Het
Fras1 A T 5: 96,645,948 H1043L probably benign Het
Gamt C A 10: 80,259,907 R63L possibly damaging Het
Gm1527 A G 3: 28,915,395 H298R probably benign Het
Gphb5 C T 12: 75,415,822 probably null Het
Greb1 A T 12: 16,733,421 V104D possibly damaging Het
Hck A G 2: 153,129,076 D86G probably damaging Het
Jhy T A 9: 40,922,662 K321* probably null Het
Kcna5 C T 6: 126,534,736 R143H probably damaging Het
Kif19a G T 11: 114,789,438 W867L possibly damaging Het
Map3k4 G A 17: 12,271,416 A376V probably damaging Het
Mars A T 10: 127,298,045 M661K probably benign Het
Mfsd2b A T 12: 4,867,651 C132S probably damaging Het
Mfsd4a T C 1: 132,038,928 Y356C probably damaging Het
Mif4gd G T 11: 115,609,362 A89E probably benign Het
Mkln1 A T 6: 31,490,547 E593D probably benign Het
Mlh1 G T 9: 111,228,495 N749K possibly damaging Het
Mrgprb2 T A 7: 48,551,959 *339C probably null Het
Nphp4 T C 4: 152,547,079 V812A probably benign Het
Nrcam G T 12: 44,576,771 V1048L probably benign Het
Obsl1 G A 1: 75,493,859 A856V probably damaging Het
Osgepl1 T A 1: 53,318,167 F163I probably damaging Het
Pcdha6 C A 18: 36,969,068 T438K possibly damaging Het
Pcdhb20 A T 18: 37,505,233 M271L probably benign Het
Phip T C 9: 82,906,952 T770A probably benign Het
Ppm1d A G 11: 85,326,908 T166A probably damaging Het
Ptprf A T 4: 118,224,735 I1102K probably benign Het
Sbsn T C 7: 30,753,267 V569A possibly damaging Het
Skida1 T A 2: 18,046,003 probably benign Het
Smg1 T A 7: 118,190,586 probably benign Het
Sorcs2 A G 5: 36,229,191 Y168H probably damaging Het
Sufu A T 19: 46,454,733 probably null Het
Tbc1d24 A T 17: 24,185,526 W215R probably damaging Het
Tenm4 T C 7: 96,902,860 L2502P probably damaging Het
Tgm4 A T 9: 123,061,638 E10V probably damaging Het
Trip11 T C 12: 101,885,972 E611G probably damaging Het
Ttn C A 2: 76,709,899 A34248S possibly damaging Het
Ube3a T A 7: 59,272,028 N49K probably damaging Het
Ube3c A G 5: 29,658,292 D855G possibly damaging Het
Ugt8a A G 3: 125,875,553 S301P probably benign Het
Wdfy4 T A 14: 33,102,577 N1295I possibly damaging Het
Wdr47 G T 3: 108,610,012 G43C probably damaging Het
Wdtc1 A C 4: 133,294,362 L601W unknown Het
Zfp236 A G 18: 82,640,151 F614S possibly damaging Het
Zfp637 T A 6: 117,845,086 D58E possibly damaging Het
Other mutations in Mecp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01520:Mecp2 APN X 74035841 missense possibly damaging 0.53
R1387:Mecp2 UTSW X 74035788 missense possibly damaging 0.93
R1888:Mecp2 UTSW X 74037175 missense probably damaging 1.00
R1888:Mecp2 UTSW X 74037175 missense probably damaging 1.00
R1891:Mecp2 UTSW X 74037175 missense probably damaging 1.00
R1894:Mecp2 UTSW X 74037175 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAACCTGACTGTGCTTGTC -3'
(R):5'- AGGCTCACTGGAAAGCGATG -3'

Sequencing Primer
(F):5'- GTGCTTGTCGGTAAGAAAAACATCC -3'
(R):5'- TGGCTGCCCCAAGGAGC -3'
Posted On2017-02-15