Incidental Mutation 'R5891:Slco5a1'
ID457140
Institutional Source Beutler Lab
Gene Symbol Slco5a1
Ensembl Gene ENSMUSG00000025938
Gene Namesolute carrier organic anion transporter family, member 5A1
SynonymsA630033C23Rik
MMRRC Submission 044092-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5891 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location12866549-12992650 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12990402 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 32 (F32L)
Ref Sequence ENSEMBL: ENSMUSP00000139586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115402] [ENSMUST00000115403] [ENSMUST00000136197] [ENSMUST00000146763] [ENSMUST00000147606] [ENSMUST00000188454]
Predicted Effect probably benign
Transcript: ENSMUST00000115402
AA Change: F32L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000111061
Gene: ENSMUSG00000025938
AA Change: F32L

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:MFS_1 137 548 3e-28 PFAM
KAZAL 559 602 3.26e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115403
AA Change: F32L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000111062
Gene: ENSMUSG00000025938
AA Change: F32L

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:MFS_1 137 547 2.8e-28 PFAM
KAZAL 559 602 3.26e-2 SMART
transmembrane domain 737 759 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136197
AA Change: F32L

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000139533
Gene: ENSMUSG00000025938
AA Change: F32L

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:MFS_1 137 548 3.6e-27 PFAM
KAZAL 559 601 4.3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146763
AA Change: F32L

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000139586
Gene: ENSMUSG00000025938
AA Change: F32L

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:OATP 130 352 8.4e-72 PFAM
Pfam:MFS_1 137 332 1.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147606
AA Change: F32L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000140658
Gene: ENSMUSG00000025938
AA Change: F32L

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:OATP 130 478 1.5e-105 PFAM
Pfam:MFS_1 137 476 2.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188454
AA Change: F32L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000140091
Gene: ENSMUSG00000025938
AA Change: F32L

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:MFS_1 137 548 4.1e-28 PFAM
KAZAL 559 602 3.26e-2 SMART
transmembrane domain 737 759 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191566
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 96% (85/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 12 transmembrane domain protein that is a member of the solute carrier organic anion transporter superfamily. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,188,589 I828V probably benign Het
A430105I19Rik T A 2: 118,761,383 D92V probably damaging Het
Abi3bp A T 16: 56,606,133 T504S probably damaging Het
Adamtsl4 C A 3: 95,682,313 R387L possibly damaging Het
Adgb G A 10: 10,377,847 Q1224* probably null Het
Ankrd40 T A 11: 94,334,863 F240Y probably damaging Het
Asnsd1 A T 1: 53,347,977 Y164N probably benign Het
Atf7ip A T 6: 136,559,977 E69D possibly damaging Het
Atm T C 9: 53,497,159 T1129A probably benign Het
AU021092 T C 16: 5,212,131 D340G probably benign Het
Baz2a T A 10: 128,121,322 I978N probably damaging Het
BC034090 T C 1: 155,233,047 probably benign Het
Bcl9 A G 3: 97,208,888 L830P probably damaging Het
Bicral T C 17: 46,801,229 N1015S probably benign Het
Ceacam3 C A 7: 17,151,793 T107N probably damaging Het
Cep83 T C 10: 94,725,675 V109A probably benign Het
Ces1e A G 8: 93,203,266 V463A possibly damaging Het
Ciao1 A G 2: 127,247,134 V55A probably benign Het
Col19a1 T C 1: 24,289,725 E900G probably damaging Het
Commd3 A G 2: 18,673,815 probably benign Het
Coro1c A G 5: 113,850,811 I157T probably damaging Het
Ctso T A 3: 81,954,254 F311L probably benign Het
Cxcl10 A G 5: 92,348,224 probably benign Het
Daam1 C A 12: 71,944,149 T179N unknown Het
Ddx24 T C 12: 103,424,058 K225E probably damaging Het
Dnajc16 T C 4: 141,775,392 T278A probably benign Het
Dnajc2 A T 5: 21,761,711 N345K possibly damaging Het
Dnpep G T 1: 75,311,812 Q395K probably benign Het
Dync1h1 T C 12: 110,614,220 probably null Het
Exoc1 A G 5: 76,542,144 D177G probably damaging Het
Fam135b C T 15: 71,525,803 R136H probably damaging Het
Fam214a C G 9: 75,004,386 C46W probably damaging Het
Filip1 T G 9: 79,819,860 L492F possibly damaging Het
Flvcr2 A T 12: 85,796,228 I359F possibly damaging Het
Gmcl1 A G 6: 86,707,443 W366R probably damaging Het
Htt A G 5: 34,870,823 T1808A possibly damaging Het
Ighv5-4 C A 12: 113,597,629 R57L probably damaging Het
Il12rb2 A T 6: 67,360,690 I69N probably damaging Het
Irf5 A T 6: 29,529,425 probably benign Het
Kif13b T G 14: 64,788,405 probably null Het
Klkb1 T A 8: 45,270,666 T571S probably benign Het
Mapkbp1 G T 2: 120,023,932 E1337* probably null Het
Met A G 6: 17,491,539 D100G probably benign Het
Mgam T A 6: 40,744,348 D183E probably benign Het
Mrgprb13 T C 7: 48,312,259 noncoding transcript Het
Mrgprx2 T C 7: 48,482,246 T275A probably benign Het
Mroh2a C A 1: 88,241,615 Q671K possibly damaging Het
Nckipsd T A 9: 108,808,609 S42R probably damaging Het
Nlrp12 T A 7: 3,219,259 probably benign Het
Olfr1297 A T 2: 111,621,433 L214M probably damaging Het
Olfr361 T A 2: 37,084,978 M257L probably benign Het
Olfr467 C T 7: 107,815,180 P199S probably damaging Het
Olfr527 C T 7: 140,336,600 T246I probably benign Het
Otoa T A 7: 121,132,360 probably null Het
Pfkm T A 15: 98,122,690 C233* probably null Het
Pikfyve A G 1: 65,202,737 Y212C probably damaging Het
Ptprq T A 10: 107,576,895 D1781V possibly damaging Het
Pttg1ip A G 10: 77,582,440 probably benign Het
Rab6a T A 7: 100,639,247 probably null Het
Rbm11 C T 16: 75,598,837 A132V possibly damaging Het
Sept4 G T 11: 87,588,924 probably benign Het
Serpinb8 A G 1: 107,605,845 E210G probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Smad2 A G 18: 76,299,975 E326G probably damaging Het
Sp9 T A 2: 73,274,251 L383Q probably damaging Het
Stx11 T C 10: 12,941,815 N55S probably damaging Het
Tbc1d15 T A 10: 115,220,308 Q253L probably benign Het
Tcf7l1 T A 6: 72,637,051 probably benign Het
Tdrd9 T A 12: 112,042,719 S1020T probably damaging Het
Tead3 A T 17: 28,341,365 D88E probably damaging Het
Tnrc18 A G 5: 142,815,171 S11P probably damaging Homo
Trpc3 G T 3: 36,671,022 D268E probably damaging Het
Ttn A G 2: 76,745,741 V23190A possibly damaging Het
Ubr4 T A 4: 139,408,626 Y908* probably null Het
Urb2 G T 8: 124,030,856 V1101L possibly damaging Het
Usp9y A T Y: 1,341,535 D1375E probably benign Het
Zcchc7 T C 4: 44,895,838 L262P probably damaging Het
Zdhhc7 T A 8: 120,084,900 H188L probably benign Het
Zfp518a T A 19: 40,912,433 C269S probably damaging Het
Zfp933 T C 4: 147,826,774 K90E probably benign Het
Other mutations in Slco5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02264:Slco5a1 APN 1 12871995 missense probably benign 0.01
IGL02330:Slco5a1 APN 1 12939060 missense probably damaging 1.00
IGL02660:Slco5a1 APN 1 12989636 missense probably damaging 1.00
IGL02904:Slco5a1 APN 1 12921097 missense probably damaging 0.98
IGL02972:Slco5a1 APN 1 12990155 nonsense probably null
IGL03100:Slco5a1 APN 1 12879280 missense possibly damaging 0.67
IGL03270:Slco5a1 APN 1 12872028 missense probably benign
R0969:Slco5a1 UTSW 1 12989892 missense probably damaging 1.00
R1337:Slco5a1 UTSW 1 12939142 missense probably benign 0.01
R1434:Slco5a1 UTSW 1 12871908 missense probably benign 0.00
R1627:Slco5a1 UTSW 1 12990383 missense probably damaging 1.00
R1767:Slco5a1 UTSW 1 12989615 missense probably damaging 1.00
R1893:Slco5a1 UTSW 1 12894472 missense probably damaging 1.00
R1894:Slco5a1 UTSW 1 12872259 missense probably damaging 1.00
R2301:Slco5a1 UTSW 1 12879262 missense probably damaging 0.98
R2302:Slco5a1 UTSW 1 12879262 missense probably damaging 0.98
R2303:Slco5a1 UTSW 1 12879262 missense probably damaging 0.98
R2304:Slco5a1 UTSW 1 12879262 missense probably damaging 0.98
R2349:Slco5a1 UTSW 1 12921152 missense probably damaging 1.00
R2351:Slco5a1 UTSW 1 12989934 missense probably benign 0.05
R3079:Slco5a1 UTSW 1 12879262 missense probably damaging 0.98
R3949:Slco5a1 UTSW 1 12989609 missense probably damaging 1.00
R4197:Slco5a1 UTSW 1 12894516 missense probably damaging 1.00
R4380:Slco5a1 UTSW 1 12939168 missense probably damaging 0.96
R4532:Slco5a1 UTSW 1 12879223 missense probably damaging 1.00
R4750:Slco5a1 UTSW 1 12879280 missense probably damaging 1.00
R6024:Slco5a1 UTSW 1 12944070 missense probably damaging 1.00
R6332:Slco5a1 UTSW 1 12921185 missense probably benign 0.27
R6492:Slco5a1 UTSW 1 12989927 missense probably damaging 1.00
R6860:Slco5a1 UTSW 1 12881196 intron probably benign
R6994:Slco5a1 UTSW 1 12881393 missense probably damaging 1.00
R7121:Slco5a1 UTSW 1 12990437 missense probably benign 0.00
X0065:Slco5a1 UTSW 1 12872212 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTAGTGCCTGCCGAAGTG -3'
(R):5'- AGATGTTTTGCTTCCAGGCTC -3'

Sequencing Primer
(F):5'- CCTGCCGAAGTGGATGGAG -3'
(R):5'- AGACGACTGAGTGGGCC -3'
Posted On2017-02-15