Incidental Mutation 'R0558:Ep400'
ID 45716
Institutional Source Beutler Lab
Gene Symbol Ep400
Ensembl Gene ENSMUSG00000029505
Gene Name E1A binding protein p400
Synonyms 1700020J09Rik, p400, mDomino
MMRRC Submission 038750-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0558 (G1)
Quality Score 215
Status Validated
Chromosome 5
Chromosomal Location 110812239-110918583 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to C at 110832933 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041558] [ENSMUST00000112435] [ENSMUST00000112436]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000041558
SMART Domains Protein: ENSMUSP00000049038
Gene: ENSMUSG00000029505

DomainStartEndE-ValueType
Pfam:EP400_N 1 461 1.6e-232 PFAM
low complexity region 519 532 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 598 620 N/A INTRINSIC
low complexity region 631 645 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
HSA 762 833 1.31e-31 SMART
low complexity region 908 925 N/A INTRINSIC
DEXDc 1049 1238 2.76e-15 SMART
Blast:DEXDc 1276 1317 2e-15 BLAST
low complexity region 1407 1417 N/A INTRINSIC
HELICc 1807 1893 1.17e-4 SMART
low complexity region 2006 2019 N/A INTRINSIC
low complexity region 2080 2100 N/A INTRINSIC
low complexity region 2214 2223 N/A INTRINSIC
SANT 2243 2310 3.57e-1 SMART
low complexity region 2402 2489 N/A INTRINSIC
low complexity region 2596 2608 N/A INTRINSIC
low complexity region 2644 2679 N/A INTRINSIC
low complexity region 2694 2738 N/A INTRINSIC
low complexity region 2769 2806 N/A INTRINSIC
low complexity region 2846 2883 N/A INTRINSIC
low complexity region 2933 2947 N/A INTRINSIC
low complexity region 2974 2986 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112435
SMART Domains Protein: ENSMUSP00000108054
Gene: ENSMUSG00000029505

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 447 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 635 657 N/A INTRINSIC
low complexity region 668 682 N/A INTRINSIC
low complexity region 695 723 N/A INTRINSIC
HSA 799 870 1.31e-31 SMART
low complexity region 945 962 N/A INTRINSIC
DEXDc 1086 1275 2.76e-15 SMART
Blast:DEXDc 1313 1354 2e-15 BLAST
low complexity region 1444 1454 N/A INTRINSIC
internal_repeat_1 1556 1646 6.82e-5 PROSPERO
low complexity region 1887 1900 N/A INTRINSIC
low complexity region 1961 1981 N/A INTRINSIC
low complexity region 2095 2104 N/A INTRINSIC
SANT 2124 2191 3.57e-1 SMART
low complexity region 2283 2370 N/A INTRINSIC
internal_repeat_1 2371 2463 6.82e-5 PROSPERO
low complexity region 2477 2489 N/A INTRINSIC
low complexity region 2525 2560 N/A INTRINSIC
low complexity region 2575 2619 N/A INTRINSIC
low complexity region 2645 2659 N/A INTRINSIC
low complexity region 2660 2680 N/A INTRINSIC
low complexity region 2720 2757 N/A INTRINSIC
low complexity region 2807 2821 N/A INTRINSIC
low complexity region 2848 2860 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112436
SMART Domains Protein: ENSMUSP00000108055
Gene: ENSMUSG00000029505

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 472 482 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
HSA 726 797 1.31e-31 SMART
low complexity region 872 889 N/A INTRINSIC
DEXDc 1013 1202 2.76e-15 SMART
Blast:DEXDc 1240 1281 2e-15 BLAST
low complexity region 1371 1381 N/A INTRINSIC
internal_repeat_1 1483 1573 6.76e-5 PROSPERO
HELICc 1771 1857 1.17e-4 SMART
low complexity region 1970 1983 N/A INTRINSIC
low complexity region 2044 2064 N/A INTRINSIC
low complexity region 2178 2187 N/A INTRINSIC
SANT 2207 2274 3.57e-1 SMART
low complexity region 2366 2453 N/A INTRINSIC
internal_repeat_1 2454 2546 6.76e-5 PROSPERO
low complexity region 2560 2572 N/A INTRINSIC
low complexity region 2608 2643 N/A INTRINSIC
low complexity region 2658 2702 N/A INTRINSIC
low complexity region 2733 2770 N/A INTRINSIC
low complexity region 2810 2847 N/A INTRINSIC
low complexity region 2897 2911 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129884
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (80/80)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die at E11.5 and display severe defects in yolk sac erythropoiesis, anemia, and a slight deformity of the neural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G A 19: 43,789,163 (GRCm39) G273R probably benign Het
Adamts10 T C 17: 33,769,583 (GRCm39) V935A probably benign Het
Anapc15-ps T C 10: 95,508,983 (GRCm39) D90G probably damaging Het
Atic T A 1: 71,602,947 (GRCm39) V107E probably benign Het
Atp4b T C 8: 13,443,523 (GRCm39) T52A possibly damaging Het
Cacna1h C T 17: 25,600,524 (GRCm39) A1606T probably damaging Het
Cacng6 T A 7: 3,483,324 (GRCm39) Y217* probably null Het
Cc2d2a T G 5: 43,881,729 (GRCm39) probably benign Het
Cd226 T A 18: 89,225,338 (GRCm39) H78Q probably benign Het
Cers3 A G 7: 66,433,166 (GRCm39) D161G probably damaging Het
Ces1f T C 8: 94,002,017 (GRCm39) H37R probably benign Het
Cfhr4 A G 1: 139,667,230 (GRCm39) V376A probably damaging Het
Chek1 T A 9: 36,623,411 (GRCm39) N421I possibly damaging Het
Cibar1 T C 4: 12,164,095 (GRCm39) D248G probably damaging Het
Cma2 T C 14: 56,210,249 (GRCm39) Y45H probably damaging Het
Cmas C A 6: 142,720,970 (GRCm39) Y401* probably null Het
Cyp2j8 A T 4: 96,332,871 (GRCm39) S492T probably benign Het
Dnah12 T C 14: 26,430,465 (GRCm39) S358P probably benign Het
Dnajc13 T C 9: 104,079,151 (GRCm39) probably null Het
Fam209 T A 2: 172,314,758 (GRCm39) N82K probably benign Het
G3bp2 A T 5: 92,221,056 (GRCm39) Y20N probably damaging Het
Gli2 T C 1: 118,765,379 (GRCm39) D924G probably benign Het
Gm10787 T C 10: 76,857,850 (GRCm39) noncoding transcript Het
Gm11568 A G 11: 99,748,872 (GRCm39) R26G unknown Het
Hivep3 T G 4: 119,953,763 (GRCm39) L693R probably damaging Het
Hook1 A G 4: 95,881,449 (GRCm39) probably benign Het
Ibtk A C 9: 85,619,591 (GRCm39) D116E probably damaging Het
Insrr C T 3: 87,718,288 (GRCm39) T927I possibly damaging Het
Irx1 T G 13: 72,107,747 (GRCm39) S312R probably benign Het
Itga11 T C 9: 62,659,570 (GRCm39) Y441H probably benign Het
Itsn1 A G 16: 91,696,511 (GRCm39) D38G possibly damaging Het
Kat6b G T 14: 21,719,489 (GRCm39) E1280D probably benign Het
Kcnk10 T A 12: 98,402,560 (GRCm39) Y293F possibly damaging Het
Krt74 T A 15: 101,669,398 (GRCm39) noncoding transcript Het
Lars1 T G 18: 42,347,902 (GRCm39) I974L probably benign Het
Limch1 A G 5: 67,126,498 (GRCm39) D42G probably damaging Het
Mau2 G C 8: 70,495,082 (GRCm39) T85R probably damaging Het
Mkrn3 A G 7: 62,068,612 (GRCm39) I393T probably benign Het
Mpl A C 4: 118,301,217 (GRCm39) S541R probably damaging Het
Nfrkb T C 9: 31,321,564 (GRCm39) S754P possibly damaging Het
Or4c125 A G 2: 89,170,580 (GRCm39) L22P probably benign Het
Or5bw2 T C 7: 6,573,652 (GRCm39) Y221H possibly damaging Het
Or5d41 A G 2: 88,054,818 (GRCm39) V186A possibly damaging Het
Or8g18 T A 9: 39,149,496 (GRCm39) T75S probably damaging Het
P2rx7 A T 5: 122,811,861 (GRCm39) I391F possibly damaging Het
Pbrm1 T A 14: 30,807,016 (GRCm39) probably null Het
Pcdh8 T C 14: 80,007,516 (GRCm39) D349G probably damaging Het
Pias1 A G 9: 62,789,291 (GRCm39) S639P possibly damaging Het
Pkhd1l1 A T 15: 44,347,820 (GRCm39) I232F probably damaging Het
Plxnc1 C T 10: 94,673,797 (GRCm39) R995Q probably damaging Het
Pnliprp2 T A 19: 58,762,519 (GRCm39) S375T probably benign Het
Prkar1b C T 5: 139,005,847 (GRCm39) V313M probably benign Het
Prr35 T C 17: 26,166,523 (GRCm39) N338S probably benign Het
Ptpn13 T C 5: 103,677,583 (GRCm39) S734P probably damaging Het
Rdh1 T C 10: 127,595,810 (GRCm39) W2R possibly damaging Het
Rsph10b A T 5: 143,886,156 (GRCm39) I285L probably benign Het
Rubcnl T C 14: 75,284,987 (GRCm39) F502S probably damaging Het
Ryr2 T A 13: 11,653,329 (GRCm39) I3693F probably damaging Het
Ryr2 T C 13: 11,814,747 (GRCm39) Y675C probably damaging Het
Scaper T C 9: 55,593,207 (GRCm39) T477A probably benign Het
Scn2a G T 2: 65,542,269 (GRCm39) V791L probably benign Het
Sdk1 A T 5: 142,117,820 (GRCm39) T1573S probably damaging Het
Sema3c A T 5: 17,919,413 (GRCm39) H483L probably benign Het
Sema6c T C 3: 95,076,002 (GRCm39) S219P probably damaging Het
Slc10a5 T G 3: 10,400,177 (GRCm39) E161A probably damaging Het
Slc22a23 C T 13: 34,528,366 (GRCm39) G139S possibly damaging Het
Slc34a3 C T 2: 25,123,077 (GRCm39) probably benign Het
Slc38a9 A T 13: 112,865,730 (GRCm39) probably null Het
Taok1 A C 11: 77,450,670 (GRCm39) S367R possibly damaging Het
Tlr6 G A 5: 65,112,203 (GRCm39) Q235* probably null Het
Top2a A G 11: 98,887,665 (GRCm39) V1281A probably benign Het
Tpgs1 T C 10: 79,511,616 (GRCm39) Y253H probably damaging Het
Tubgcp3 T C 8: 12,703,462 (GRCm39) T288A probably benign Het
Ubr4 A G 4: 139,154,213 (GRCm39) E2140G probably benign Het
Uso1 A G 5: 92,321,878 (GRCm39) Q257R probably benign Het
Zfp106 A G 2: 120,362,677 (GRCm39) V48A probably damaging Het
Zfp174 T A 16: 3,666,118 (GRCm39) S128T possibly damaging Het
Zscan26 T A 13: 21,629,225 (GRCm39) D426V probably benign Het
Other mutations in Ep400
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ep400 APN 5 110,835,707 (GRCm39) missense unknown
IGL00585:Ep400 APN 5 110,903,771 (GRCm39) missense possibly damaging 0.70
IGL00586:Ep400 APN 5 110,887,460 (GRCm39) missense probably damaging 1.00
IGL00816:Ep400 APN 5 110,883,356 (GRCm39) unclassified probably benign
IGL01066:Ep400 APN 5 110,816,065 (GRCm39) splice site probably benign
IGL01302:Ep400 APN 5 110,889,914 (GRCm39) missense probably benign 0.00
IGL01568:Ep400 APN 5 110,867,361 (GRCm39) missense unknown
IGL01833:Ep400 APN 5 110,827,874 (GRCm39) missense unknown
IGL02086:Ep400 APN 5 110,824,809 (GRCm39) splice site probably benign
IGL02266:Ep400 APN 5 110,843,163 (GRCm39) unclassified probably benign
IGL02288:Ep400 APN 5 110,831,702 (GRCm39) splice site probably benign
IGL02301:Ep400 APN 5 110,822,826 (GRCm39) missense probably damaging 1.00
IGL02377:Ep400 APN 5 110,868,691 (GRCm39) missense unknown
IGL02382:Ep400 APN 5 110,849,594 (GRCm39) missense unknown
IGL02419:Ep400 APN 5 110,845,242 (GRCm39) splice site probably null
IGL02591:Ep400 APN 5 110,881,638 (GRCm39) unclassified probably benign
IGL02981:Ep400 APN 5 110,839,476 (GRCm39) splice site probably benign
IGL02981:Ep400 APN 5 110,903,969 (GRCm39) missense possibly damaging 0.79
IGL03173:Ep400 APN 5 110,856,737 (GRCm39) unclassified probably benign
IGL03244:Ep400 APN 5 110,875,429 (GRCm39) missense unknown
IGL03333:Ep400 APN 5 110,851,432 (GRCm39) missense unknown
santol UTSW 5 110,849,537 (GRCm39) missense unknown
PIT4243001:Ep400 UTSW 5 110,883,446 (GRCm39) missense unknown
PIT4260001:Ep400 UTSW 5 110,841,037 (GRCm39) nonsense probably null
R0017:Ep400 UTSW 5 110,821,395 (GRCm39) missense probably damaging 1.00
R0179:Ep400 UTSW 5 110,816,515 (GRCm39) missense probably damaging 0.99
R0243:Ep400 UTSW 5 110,872,273 (GRCm39) splice site probably benign
R0366:Ep400 UTSW 5 110,849,537 (GRCm39) missense unknown
R0508:Ep400 UTSW 5 110,887,374 (GRCm39) missense probably benign 0.00
R0541:Ep400 UTSW 5 110,852,882 (GRCm39) missense unknown
R0576:Ep400 UTSW 5 110,858,959 (GRCm39) unclassified probably benign
R0595:Ep400 UTSW 5 110,851,408 (GRCm39) missense unknown
R0671:Ep400 UTSW 5 110,836,062 (GRCm39) missense unknown
R0763:Ep400 UTSW 5 110,813,703 (GRCm39) missense probably damaging 1.00
R1078:Ep400 UTSW 5 110,883,388 (GRCm39) unclassified probably benign
R1300:Ep400 UTSW 5 110,821,426 (GRCm39) missense probably damaging 1.00
R1439:Ep400 UTSW 5 110,833,344 (GRCm39) missense unknown
R1520:Ep400 UTSW 5 110,839,644 (GRCm39) intron probably benign
R1529:Ep400 UTSW 5 110,887,311 (GRCm39) missense probably benign 0.00
R1535:Ep400 UTSW 5 110,856,032 (GRCm39) unclassified probably benign
R1560:Ep400 UTSW 5 110,818,972 (GRCm39) splice site probably null
R1587:Ep400 UTSW 5 110,874,768 (GRCm39) missense probably benign 0.23
R1596:Ep400 UTSW 5 110,856,727 (GRCm39) unclassified probably benign
R1653:Ep400 UTSW 5 110,841,040 (GRCm39) nonsense probably null
R1711:Ep400 UTSW 5 110,841,174 (GRCm39) unclassified probably benign
R1774:Ep400 UTSW 5 110,833,357 (GRCm39) missense unknown
R1836:Ep400 UTSW 5 110,852,920 (GRCm39) missense unknown
R1905:Ep400 UTSW 5 110,818,814 (GRCm39) missense probably damaging 1.00
R1917:Ep400 UTSW 5 110,851,441 (GRCm39) missense unknown
R2064:Ep400 UTSW 5 110,883,270 (GRCm39) unclassified probably benign
R2122:Ep400 UTSW 5 110,856,716 (GRCm39) unclassified probably benign
R2144:Ep400 UTSW 5 110,851,384 (GRCm39) missense unknown
R2215:Ep400 UTSW 5 110,841,421 (GRCm39) unclassified probably benign
R2252:Ep400 UTSW 5 110,866,957 (GRCm39) missense unknown
R2253:Ep400 UTSW 5 110,866,957 (GRCm39) missense unknown
R2483:Ep400 UTSW 5 110,867,102 (GRCm39) missense unknown
R2504:Ep400 UTSW 5 110,816,511 (GRCm39) missense probably damaging 1.00
R2512:Ep400 UTSW 5 110,856,781 (GRCm39) unclassified probably benign
R2842:Ep400 UTSW 5 110,846,681 (GRCm39) nonsense probably null
R2920:Ep400 UTSW 5 110,903,780 (GRCm39) missense probably damaging 1.00
R3082:Ep400 UTSW 5 110,841,096 (GRCm39) unclassified probably benign
R3151:Ep400 UTSW 5 110,851,435 (GRCm39) missense unknown
R3552:Ep400 UTSW 5 110,877,153 (GRCm39) missense unknown
R3623:Ep400 UTSW 5 110,867,102 (GRCm39) missense unknown
R3779:Ep400 UTSW 5 110,839,515 (GRCm39) missense unknown
R3923:Ep400 UTSW 5 110,904,389 (GRCm39) missense possibly damaging 0.55
R4062:Ep400 UTSW 5 110,889,847 (GRCm39) missense probably benign 0.10
R4508:Ep400 UTSW 5 110,851,481 (GRCm39) missense unknown
R4584:Ep400 UTSW 5 110,881,763 (GRCm39) unclassified probably benign
R4585:Ep400 UTSW 5 110,901,725 (GRCm39) missense probably damaging 1.00
R4586:Ep400 UTSW 5 110,901,725 (GRCm39) missense probably damaging 1.00
R4807:Ep400 UTSW 5 110,843,444 (GRCm39) splice site probably null
R4921:Ep400 UTSW 5 110,813,676 (GRCm39) missense probably damaging 1.00
R4976:Ep400 UTSW 5 110,868,622 (GRCm39) missense unknown
R4976:Ep400 UTSW 5 110,846,678 (GRCm39) missense unknown
R5075:Ep400 UTSW 5 110,833,351 (GRCm39) missense unknown
R5120:Ep400 UTSW 5 110,904,224 (GRCm39) missense probably damaging 1.00
R5122:Ep400 UTSW 5 110,816,036 (GRCm39) missense probably damaging 1.00
R5223:Ep400 UTSW 5 110,816,496 (GRCm39) missense probably damaging 1.00
R5284:Ep400 UTSW 5 110,815,990 (GRCm39) missense probably damaging 1.00
R5388:Ep400 UTSW 5 110,849,594 (GRCm39) missense unknown
R5401:Ep400 UTSW 5 110,831,037 (GRCm39) missense unknown
R5431:Ep400 UTSW 5 110,824,420 (GRCm39) missense unknown
R5461:Ep400 UTSW 5 110,824,550 (GRCm39) nonsense probably null
R5568:Ep400 UTSW 5 110,904,071 (GRCm39) missense probably damaging 1.00
R5650:Ep400 UTSW 5 110,843,818 (GRCm39) critical splice donor site probably null
R5778:Ep400 UTSW 5 110,867,450 (GRCm39) missense unknown
R5806:Ep400 UTSW 5 110,903,420 (GRCm39) nonsense probably null
R5814:Ep400 UTSW 5 110,843,444 (GRCm39) splice site probably null
R5830:Ep400 UTSW 5 110,831,862 (GRCm39) missense unknown
R5882:Ep400 UTSW 5 110,903,453 (GRCm39) missense probably benign 0.00
R5931:Ep400 UTSW 5 110,883,386 (GRCm39) unclassified probably benign
R5945:Ep400 UTSW 5 110,830,732 (GRCm39) missense unknown
R5966:Ep400 UTSW 5 110,824,766 (GRCm39) missense unknown
R5973:Ep400 UTSW 5 110,877,697 (GRCm39) missense unknown
R5980:Ep400 UTSW 5 110,881,595 (GRCm39) unclassified probably benign
R6000:Ep400 UTSW 5 110,831,067 (GRCm39) missense unknown
R6006:Ep400 UTSW 5 110,852,825 (GRCm39) missense unknown
R6053:Ep400 UTSW 5 110,903,661 (GRCm39) missense probably benign 0.22
R6145:Ep400 UTSW 5 110,904,569 (GRCm39) missense possibly damaging 0.95
R6154:Ep400 UTSW 5 110,903,799 (GRCm39) missense probably damaging 0.97
R6169:Ep400 UTSW 5 110,889,863 (GRCm39) missense possibly damaging 0.83
R6228:Ep400 UTSW 5 110,818,808 (GRCm39) missense probably damaging 1.00
R6295:Ep400 UTSW 5 110,901,675 (GRCm39) missense probably benign 0.00
R6486:Ep400 UTSW 5 110,845,084 (GRCm39) unclassified probably benign
R6504:Ep400 UTSW 5 110,856,703 (GRCm39) unclassified probably benign
R6607:Ep400 UTSW 5 110,831,180 (GRCm39) missense unknown
R6657:Ep400 UTSW 5 110,841,411 (GRCm39) unclassified probably benign
R6660:Ep400 UTSW 5 110,867,313 (GRCm39) nonsense probably null
R6741:Ep400 UTSW 5 110,824,761 (GRCm39) missense unknown
R6933:Ep400 UTSW 5 110,813,728 (GRCm39) missense probably damaging 1.00
R6937:Ep400 UTSW 5 110,859,018 (GRCm39) unclassified probably benign
R7069:Ep400 UTSW 5 110,815,990 (GRCm39) missense probably damaging 1.00
R7103:Ep400 UTSW 5 110,881,651 (GRCm39) missense unknown
R7156:Ep400 UTSW 5 110,833,229 (GRCm39) missense unknown
R7272:Ep400 UTSW 5 110,903,511 (GRCm39) nonsense probably null
R7365:Ep400 UTSW 5 110,867,480 (GRCm39) missense unknown
R7581:Ep400 UTSW 5 110,903,891 (GRCm39) missense unknown
R7684:Ep400 UTSW 5 110,845,218 (GRCm39) missense unknown
R7699:Ep400 UTSW 5 110,843,898 (GRCm39) missense unknown
R7700:Ep400 UTSW 5 110,843,898 (GRCm39) missense unknown
R7856:Ep400 UTSW 5 110,814,450 (GRCm39) missense probably damaging 0.99
R7954:Ep400 UTSW 5 110,816,599 (GRCm39) missense possibly damaging 0.46
R8098:Ep400 UTSW 5 110,841,117 (GRCm39) missense unknown
R8108:Ep400 UTSW 5 110,835,749 (GRCm39) missense unknown
R8260:Ep400 UTSW 5 110,903,478 (GRCm39) nonsense probably null
R8293:Ep400 UTSW 5 110,856,758 (GRCm39) missense unknown
R8314:Ep400 UTSW 5 110,903,619 (GRCm39) missense unknown
R8351:Ep400 UTSW 5 110,887,200 (GRCm39) missense probably damaging 1.00
R8424:Ep400 UTSW 5 110,841,144 (GRCm39) missense unknown
R8459:Ep400 UTSW 5 110,856,757 (GRCm39) missense unknown
R8529:Ep400 UTSW 5 110,867,102 (GRCm39) missense unknown
R8688:Ep400 UTSW 5 110,868,685 (GRCm39) missense unknown
R8744:Ep400 UTSW 5 110,889,925 (GRCm39) missense unknown
R8923:Ep400 UTSW 5 110,831,864 (GRCm39) missense unknown
R9005:Ep400 UTSW 5 110,858,959 (GRCm39) missense unknown
R9087:Ep400 UTSW 5 110,815,430 (GRCm39) nonsense probably null
R9146:Ep400 UTSW 5 110,849,635 (GRCm39) nonsense probably null
R9383:Ep400 UTSW 5 110,833,351 (GRCm39) missense unknown
R9479:Ep400 UTSW 5 110,877,730 (GRCm39) missense unknown
R9496:Ep400 UTSW 5 110,855,853 (GRCm39) missense unknown
R9582:Ep400 UTSW 5 110,824,315 (GRCm39) critical splice donor site probably null
R9607:Ep400 UTSW 5 110,831,805 (GRCm39) missense unknown
R9712:Ep400 UTSW 5 110,904,509 (GRCm39) missense unknown
R9746:Ep400 UTSW 5 110,889,872 (GRCm39) missense unknown
X0012:Ep400 UTSW 5 110,821,062 (GRCm39) small deletion probably benign
X0021:Ep400 UTSW 5 110,830,730 (GRCm39) missense unknown
Z1176:Ep400 UTSW 5 110,904,501 (GRCm39) missense unknown
Z1177:Ep400 UTSW 5 110,881,609 (GRCm39) missense unknown
Z1177:Ep400 UTSW 5 110,831,230 (GRCm39) missense unknown
Z1188:Ep400 UTSW 5 110,903,549 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TCAGTCAGCCCCAAGTTGCTTC -3'
(R):5'- TGTCTCCTCAGACTCAGATGGCTC -3'

Sequencing Primer
(F):5'- CCAAGTTGCTTCCAAACTAGTG -3'
(R):5'- CTCAGATGGCTCTAGATATGACG -3'
Posted On 2013-06-11