Incidental Mutation 'R5891:Dnajc2'
ID457163
Institutional Source Beutler Lab
Gene Symbol Dnajc2
Ensembl Gene ENSMUSG00000029014
Gene NameDnaJ heat shock protein family (Hsp40) member C2
SynonymsMIDA1, Zrf1, Mida1, Zrf2
MMRRC Submission 044092-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R5891 (G1)
Quality Score209
Status Validated
Chromosome5
Chromosomal Location21757267-21785251 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21761711 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 345 (N345K)
Ref Sequence ENSEMBL: ENSMUSP00000110849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030771] [ENSMUST00000030882] [ENSMUST00000115193] [ENSMUST00000115195]
Predicted Effect probably benign
Transcript: ENSMUST00000030771
AA Change: N419K

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030771
Gene: ENSMUSG00000029014
AA Change: N419K

DomainStartEndE-ValueType
coiled coil region 39 67 N/A INTRINSIC
DnaJ 87 153 2.16e-18 SMART
low complexity region 231 245 N/A INTRINSIC
low complexity region 281 319 N/A INTRINSIC
Pfam:RAC_head 339 430 2.8e-24 PFAM
SANT 450 509 6.64e-10 SMART
SANT 550 602 2.4e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030882
SMART Domains Protein: ENSMUSP00000030882
Gene: ENSMUSG00000029017

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:Peptidase_M16 68 215 6.1e-59 PFAM
Pfam:Peptidase_M16_C 220 404 4.1e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115193
AA Change: N419K

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110847
Gene: ENSMUSG00000029014
AA Change: N419K

DomainStartEndE-ValueType
coiled coil region 39 67 N/A INTRINSIC
DnaJ 87 153 2.16e-18 SMART
coiled coil region 230 358 N/A INTRINSIC
coiled coil region 404 445 N/A INTRINSIC
SANT 450 509 6.64e-10 SMART
SANT 550 602 1.34e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115195
AA Change: N345K

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110849
Gene: ENSMUSG00000029014
AA Change: N345K

DomainStartEndE-ValueType
DnaJ 13 79 2.16e-18 SMART
coiled coil region 156 284 N/A INTRINSIC
coiled coil region 330 371 N/A INTRINSIC
SANT 376 435 6.64e-10 SMART
SANT 476 528 2.4e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137334
Predicted Effect probably benign
Transcript: ENSMUST00000141022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152440
Meta Mutation Damage Score 0.1173 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 96% (85/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the M-phase phosphoprotein (MPP) family. The gene encodes a phosphoprotein with a J domain and a Myb DNA-binding domain which localizes to both the nucleus and the cytosol. The protein is capable of forming a heterodimeric complex that associates with ribosomes, acting as a molecular chaperone for nascent polypeptide chains as they exit the ribosome. This protein was identified as a leukemia-associated antigen and expression of the gene is upregulated in leukemic blasts. Also, chromosomal aberrations involving this gene are associated with primary head and neck squamous cell tumors. This gene has a pseudogene on chromosome 6. Alternatively spliced variants which encode different protein isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,188,589 I828V probably benign Het
A430105I19Rik T A 2: 118,761,383 D92V probably damaging Het
Abi3bp A T 16: 56,606,133 T504S probably damaging Het
Adamtsl4 C A 3: 95,682,313 R387L possibly damaging Het
Adgb G A 10: 10,377,847 Q1224* probably null Het
Ankrd40 T A 11: 94,334,863 F240Y probably damaging Het
Asnsd1 A T 1: 53,347,977 Y164N probably benign Het
Atf7ip A T 6: 136,559,977 E69D possibly damaging Het
Atm T C 9: 53,497,159 T1129A probably benign Het
AU021092 T C 16: 5,212,131 D340G probably benign Het
Baz2a T A 10: 128,121,322 I978N probably damaging Het
BC034090 T C 1: 155,233,047 probably benign Het
Bcl9 A G 3: 97,208,888 L830P probably damaging Het
Bicral T C 17: 46,801,229 N1015S probably benign Het
Ceacam3 C A 7: 17,151,793 T107N probably damaging Het
Cep83 T C 10: 94,725,675 V109A probably benign Het
Ces1e A G 8: 93,203,266 V463A possibly damaging Het
Ciao1 A G 2: 127,247,134 V55A probably benign Het
Col19a1 T C 1: 24,289,725 E900G probably damaging Het
Commd3 A G 2: 18,673,815 probably benign Het
Coro1c A G 5: 113,850,811 I157T probably damaging Het
Ctso T A 3: 81,954,254 F311L probably benign Het
Cxcl10 A G 5: 92,348,224 probably benign Het
Daam1 C A 12: 71,944,149 T179N unknown Het
Ddx24 T C 12: 103,424,058 K225E probably damaging Het
Dnajc16 T C 4: 141,775,392 T278A probably benign Het
Dnpep G T 1: 75,311,812 Q395K probably benign Het
Dync1h1 T C 12: 110,614,220 probably null Het
Exoc1 A G 5: 76,542,144 D177G probably damaging Het
Fam135b C T 15: 71,525,803 R136H probably damaging Het
Fam214a C G 9: 75,004,386 C46W probably damaging Het
Filip1 T G 9: 79,819,860 L492F possibly damaging Het
Flvcr2 A T 12: 85,796,228 I359F possibly damaging Het
Gmcl1 A G 6: 86,707,443 W366R probably damaging Het
Htt A G 5: 34,870,823 T1808A possibly damaging Het
Ighv5-4 C A 12: 113,597,629 R57L probably damaging Het
Il12rb2 A T 6: 67,360,690 I69N probably damaging Het
Irf5 A T 6: 29,529,425 probably benign Het
Kif13b T G 14: 64,788,405 probably null Het
Klkb1 T A 8: 45,270,666 T571S probably benign Het
Mapkbp1 G T 2: 120,023,932 E1337* probably null Het
Met A G 6: 17,491,539 D100G probably benign Het
Mgam T A 6: 40,744,348 D183E probably benign Het
Mrgprb13 T C 7: 48,312,259 noncoding transcript Het
Mrgprx2 T C 7: 48,482,246 T275A probably benign Het
Mroh2a C A 1: 88,241,615 Q671K possibly damaging Het
Nckipsd T A 9: 108,808,609 S42R probably damaging Het
Nlrp12 T A 7: 3,219,259 probably benign Het
Olfr1297 A T 2: 111,621,433 L214M probably damaging Het
Olfr361 T A 2: 37,084,978 M257L probably benign Het
Olfr467 C T 7: 107,815,180 P199S probably damaging Het
Olfr527 C T 7: 140,336,600 T246I probably benign Het
Otoa T A 7: 121,132,360 probably null Het
Pfkm T A 15: 98,122,690 C233* probably null Het
Pikfyve A G 1: 65,202,737 Y212C probably damaging Het
Ptprq T A 10: 107,576,895 D1781V possibly damaging Het
Pttg1ip A G 10: 77,582,440 probably benign Het
Rab6a T A 7: 100,639,247 probably null Het
Rbm11 C T 16: 75,598,837 A132V possibly damaging Het
Sept4 G T 11: 87,588,924 probably benign Het
Serpinb8 A G 1: 107,605,845 E210G probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Slco5a1 A G 1: 12,990,402 F32L probably benign Het
Smad2 A G 18: 76,299,975 E326G probably damaging Het
Sp9 T A 2: 73,274,251 L383Q probably damaging Het
Stx11 T C 10: 12,941,815 N55S probably damaging Het
Tbc1d15 T A 10: 115,220,308 Q253L probably benign Het
Tcf7l1 T A 6: 72,637,051 probably benign Het
Tdrd9 T A 12: 112,042,719 S1020T probably damaging Het
Tead3 A T 17: 28,341,365 D88E probably damaging Het
Tnrc18 A G 5: 142,815,171 S11P probably damaging Homo
Trpc3 G T 3: 36,671,022 D268E probably damaging Het
Ttn A G 2: 76,745,741 V23190A possibly damaging Het
Ubr4 T A 4: 139,408,626 Y908* probably null Het
Urb2 G T 8: 124,030,856 V1101L possibly damaging Het
Usp9y A T Y: 1,341,535 D1375E probably benign Het
Zcchc7 T C 4: 44,895,838 L262P probably damaging Het
Zdhhc7 T A 8: 120,084,900 H188L probably benign Het
Zfp518a T A 19: 40,912,433 C269S probably damaging Het
Zfp933 T C 4: 147,826,774 K90E probably benign Het
Other mutations in Dnajc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Dnajc2 APN 5 21774976 missense possibly damaging 0.83
IGL01479:Dnajc2 APN 5 21757893 missense probably damaging 1.00
IGL01804:Dnajc2 APN 5 21757363 missense probably damaging 1.00
IGL02478:Dnajc2 APN 5 21776790 missense probably damaging 1.00
IGL02552:Dnajc2 APN 5 21783063 missense probably damaging 1.00
IGL02657:Dnajc2 APN 5 21770481 splice site probably benign
IGL02832:Dnajc2 APN 5 21760410 missense probably benign
IGL03177:Dnajc2 APN 5 21775081 splice site probably benign
R1914:Dnajc2 UTSW 5 21781319 critical splice donor site probably null
R1915:Dnajc2 UTSW 5 21781319 critical splice donor site probably null
R2024:Dnajc2 UTSW 5 21776790 missense probably damaging 1.00
R2437:Dnajc2 UTSW 5 21760391 missense probably benign 0.06
R4177:Dnajc2 UTSW 5 21757396 missense probably benign 0.28
R4451:Dnajc2 UTSW 5 21757794 missense possibly damaging 0.93
R4812:Dnajc2 UTSW 5 21763486 missense probably benign 0.03
R4916:Dnajc2 UTSW 5 21757340 missense probably damaging 1.00
R5013:Dnajc2 UTSW 5 21757773 nonsense probably null
R5094:Dnajc2 UTSW 5 21776732 missense probably damaging 1.00
R5124:Dnajc2 UTSW 5 21763484 missense probably benign
R6192:Dnajc2 UTSW 5 21768648 missense probably damaging 1.00
R6567:Dnajc2 UTSW 5 21766678 missense probably damaging 1.00
R7211:Dnajc2 UTSW 5 21776779 missense probably damaging 1.00
R7216:Dnajc2 UTSW 5 21776779 missense probably damaging 1.00
R7418:Dnajc2 UTSW 5 21760624 critical splice donor site probably null
R7728:Dnajc2 UTSW 5 21770540 missense possibly damaging 0.62
X0027:Dnajc2 UTSW 5 21773811 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CCTTGAGTTTGTTCCAGCAGG -3'
(R):5'- AATCCAAGGGCAATTCAGGCTG -3'

Sequencing Primer
(F):5'- TCCAGCAGGGAAGAGATTGAC -3'
(R):5'- CATCCTTTAACCTATGCAGTGGGG -3'
Posted On2017-02-15