Mutagenetix > Incidental Mutations

Incidental Mutation 'R0558:P2rx7'

45717

Institutional Source

Beutler Lab

Gene Symbol

P2rx7

Ensembl Gene

ENSMUSG00000029468

Gene Name

purinergic receptor P2X, ligand-gated ion channel, 7

Synonyms

P2X7R, P2X7 receptor, P2X(7)

MMRRC Submission

038750-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0558 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

122643911-122691432 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 122673798 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 391 (I391F)

Ref Sequence

ENSEMBL: ENSMUSP00000112440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031425] [ENSMUST00000100737] [ENSMUST00000121489]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031425
AA Change: I391F

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000031425
Gene: ENSMUSG00000029468
AA Change: I391F

Domain	Start	End	E-Value	Type
Pfam:P2X_receptor	11	403	1e-149	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100737
AA Change: I391F

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000098303
Gene: ENSMUSG00000029468
AA Change: I391F

Domain	Start	End	E-Value	Type
Pfam:P2X_receptor	11	397	3.6e-158	PFAM
low complexity region	435	451	N/A	INTRINSIC
low complexity region	516	536	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121489
AA Change: I391F

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000112440
Gene: ENSMUSG00000029468
AA Change: I391F

Domain	Start	End	E-Value	Type
Pfam:P2X_receptor	11	403	3.5e-149	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199371

Meta Mutation Damage Score

0.1222

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.8%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel and is responsible for ATP-dependent lysis of macrophages through the formation of membrane pores permeable to large molecules. Activation of this nuclear receptor by ATP in the cytoplasm may be a mechanism by which cellular activity can be coupled to changes in gene expression. Multiple alternatively spliced variants have been identified, most of which fit nonsense-mediated decay (NMD) criteria. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene are fertile and viable with no obvious phenotypic abnormality. Cellular responses of macrophages to extracellular ATP are frequently normal however. In addition, long bones are thinner than normal in adult mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930017K11Rik	T	C	17: 25,947,549	N338S	probably benign	Het
Abcc2	G	A	19: 43,800,724	G273R	probably benign	Het
Adamts10	T	C	17: 33,550,609	V935A	probably benign	Het
Anapc15-ps	T	C	10: 95,673,121	D90G	probably damaging	Het
Atic	T	A	1: 71,563,788	V107E	probably benign	Het
Atp4b	T	C	8: 13,393,523	T52A	possibly damaging	Het
Cacna1h	C	T	17: 25,381,550	A1606T	probably damaging	Het
Cacng6	T	A	7: 3,434,808	Y217*	probably null	Het
Cc2d2a	T	G	5: 43,724,387		probably benign	Het
Cd226	T	A	18: 89,207,214	H78Q	probably benign	Het
Cers3	A	G	7: 66,783,418	D161G	probably damaging	Het
Ces1f	T	C	8: 93,275,389	H37R	probably benign	Het
Chek1	T	A	9: 36,712,115	N421I	possibly damaging	Het
Cma2	T	C	14: 55,972,792	Y45H	probably damaging	Het
Cmas	C	A	6: 142,775,244	Y401*	probably null	Het
Cyp2j8	A	T	4: 96,444,634	S492T	probably benign	Het
Dnah12	T	C	14: 26,709,310	S358P	probably benign	Het
Dnajc13	T	C	9: 104,201,952		probably null	Het
Ep400	A	C	5: 110,685,067		probably benign	Het
Fam209	T	A	2: 172,472,838	N82K	probably benign	Het
Fam92a	T	C	4: 12,164,095	D248G	probably damaging	Het
G3bp2	A	T	5: 92,073,197	Y20N	probably damaging	Het
Gli2	T	C	1: 118,837,649	D924G	probably benign	Het
Gm10787	T	C	10: 77,022,016		noncoding transcript	Het
Gm11568	A	G	11: 99,858,046	R26G	unknown	Het
Gm4788	A	G	1: 139,739,492	V376A	probably damaging	Het
Hivep3	T	G	4: 120,096,566	L693R	probably damaging	Het
Hook1	A	G	4: 95,993,212		probably benign	Het
Ibtk	A	C	9: 85,737,538	D116E	probably damaging	Het
Insrr	C	T	3: 87,810,981	T927I	possibly damaging	Het
Irx1	T	G	13: 71,959,628	S312R	probably benign	Het
Itga11	T	C	9: 62,752,288	Y441H	probably benign	Het
Itsn1	A	G	16: 91,899,623	D38G	possibly damaging	Het
Kat6b	G	T	14: 21,669,421	E1280D	probably benign	Het
Kcnk10	T	A	12: 98,436,301	Y293F	possibly damaging	Het
Krt74	T	A	15: 101,760,963		noncoding transcript	Het
Lars	T	G	18: 42,214,837	I974L	probably benign	Het
Limch1	A	G	5: 66,969,155	D42G	probably damaging	Het
Mau2	G	C	8: 70,042,432	T85R	probably damaging	Het
Mkrn3	A	G	7: 62,418,864	I393T	probably benign	Het
Mpl	A	C	4: 118,444,020	S541R	probably damaging	Het
Nfrkb	T	C	9: 31,410,268	S754P	possibly damaging	Het
Olfr1170	A	G	2: 88,224,474	V186A	possibly damaging	Het
Olfr1233	A	G	2: 89,340,236	L22P	probably benign	Het
Olfr1350	T	C	7: 6,570,653	Y221H	possibly damaging	Het
Olfr1537	T	A	9: 39,238,200	T75S	probably damaging	Het
Pbrm1	T	A	14: 31,085,059		probably null	Het
Pcdh8	T	C	14: 79,770,076	D349G	probably damaging	Het
Pias1	A	G	9: 62,882,009	S639P	possibly damaging	Het
Pkhd1l1	A	T	15: 44,484,424	I232F	probably damaging	Het
Plxnc1	C	T	10: 94,837,935	R995Q	probably damaging	Het
Pnliprp2	T	A	19: 58,774,087	S375T	probably benign	Het
Prkar1b	C	T	5: 139,020,092	V313M	probably benign	Het
Ptpn13	T	C	5: 103,529,717	S734P	probably damaging	Het
Rdh1	T	C	10: 127,759,941	W2R	possibly damaging	Het
Rsph10b	A	T	5: 143,949,338	I285L	probably benign	Het
Rubcnl	T	C	14: 75,047,547	F502S	probably damaging	Het
Ryr2	T	A	13: 11,638,443	I3693F	probably damaging	Het
Ryr2	T	C	13: 11,799,861	Y675C	probably damaging	Het
Scaper	T	C	9: 55,685,923	T477A	probably benign	Het
Scn2a	G	T	2: 65,711,925	V791L	probably benign	Het
Sdk1	A	T	5: 142,132,065	T1573S	probably damaging	Het
Sema3c	A	T	5: 17,714,415	H483L	probably benign	Het
Sema6c	T	C	3: 95,168,691	S219P	probably damaging	Het
Slc10a5	T	G	3: 10,335,117	E161A	probably damaging	Het
Slc22a23	C	T	13: 34,344,383	G139S	possibly damaging	Het
Slc34a3	C	T	2: 25,233,065		probably benign	Het
Slc38a9	A	T	13: 112,729,196		probably null	Het
Taok1	A	C	11: 77,559,844	S367R	possibly damaging	Het
Tlr6	G	A	5: 64,954,860	Q235*	probably null	Het
Top2a	A	G	11: 98,996,839	V1281A	probably benign	Het
Tpgs1	T	C	10: 79,675,782	Y253H	probably damaging	Het
Tubgcp3	T	C	8: 12,653,462	T288A	probably benign	Het
Ubr4	A	G	4: 139,426,902	E2140G	probably benign	Het
Uso1	A	G	5: 92,174,019	Q257R	probably benign	Het
Zfp106	A	G	2: 120,532,196	V48A	probably damaging	Het
Zfp174	T	A	16: 3,848,254	S128T	possibly damaging	Het
Zscan26	T	A	13: 21,445,055	D426V	probably benign	Het

Other mutations in P2rx7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01534:P2rx7	APN	5	122676698	missense	probably damaging	1.00
IGL01911:P2rx7	APN	5	122658768	missense	probably damaging	0.99
IGL02375:P2rx7	APN	5	122673656	splice site	probably benign
IGL02502:P2rx7	APN	5	122680987	missense	possibly damaging	0.92
IGL03102:P2rx7	APN	5	122663605	missense	possibly damaging	0.88
IGL03179:P2rx7	APN	5	122673700	missense	possibly damaging	0.66
ailing	UTSW	5	122673736	missense	probably benign
Enfermo	UTSW	5	122652789	missense	probably damaging	0.98
Incapacitated	UTSW	5	122673793	missense	probably damaging	0.99
Sickpuppy	UTSW	5	122681003	missense	probably damaging	0.96
BB009:P2rx7	UTSW	5	122644182	missense	probably benign	0.01
BB019:P2rx7	UTSW	5	122644182	missense	probably benign	0.01
PIT1430001:P2rx7	UTSW	5	122681216	missense	probably damaging	0.99
R0363:P2rx7	UTSW	5	122657030	nonsense	probably null
R1186:P2rx7	UTSW	5	122670451	missense	probably damaging	1.00
R1709:P2rx7	UTSW	5	122670465	missense	possibly damaging	0.95
R1856:P2rx7	UTSW	5	122681032	missense	probably damaging	1.00
R1899:P2rx7	UTSW	5	122673736	missense	probably benign
R1905:P2rx7	UTSW	5	122680952	missense	probably damaging	1.00
R2082:P2rx7	UTSW	5	122644095	missense	possibly damaging	0.92
R2117:P2rx7	UTSW	5	122681266	missense	probably benign	0.00
R2205:P2rx7	UTSW	5	122681101	missense	probably damaging	1.00
R2446:P2rx7	UTSW	5	122680816	missense	probably benign
R3151:P2rx7	UTSW	5	122681266	missense	probably benign	0.00
R4052:P2rx7	UTSW	5	122666277	missense	probably damaging	1.00
R4883:P2rx7	UTSW	5	122681066	missense	probably damaging	1.00
R4930:P2rx7	UTSW	5	122670479	missense	probably damaging	1.00
R5194:P2rx7	UTSW	5	122673795	missense	probably benign	0.00
R5257:P2rx7	UTSW	5	122681003	missense	probably damaging	0.96
R5258:P2rx7	UTSW	5	122681003	missense	probably damaging	0.96
R5481:P2rx7	UTSW	5	122680820	missense	possibly damaging	0.89
R5656:P2rx7	UTSW	5	122673717	missense	probably damaging	0.99
R5738:P2rx7	UTSW	5	122652789	missense	probably damaging	0.98
R6587:P2rx7	UTSW	5	122664550	missense	probably damaging	1.00
R7098:P2rx7	UTSW	5	122673793	missense	probably damaging	0.99
R7120:P2rx7	UTSW	5	122681294	missense	probably benign
R7180:P2rx7	UTSW	5	122680820	missense	possibly damaging	0.89
R7358:P2rx7	UTSW	5	122666142	critical splice acceptor site	probably null
R7724:P2rx7	UTSW	5	122673373	missense	probably benign	0.07
R7932:P2rx7	UTSW	5	122644182	missense	probably benign	0.01
R8240:P2rx7	UTSW	5	122655033	missense	probably damaging	1.00
R8425:P2rx7	UTSW	5	122670458	missense	probably damaging	0.96
Z1177:P2rx7	UTSW	5	122663641	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCACAGTCAGGGTGCTTGCTTC -3'
(R):5'- AGGAACCGGAACATAGCAGTTTGTC -3'

Sequencing Primer
(F):5'- TTCCCCACAGGCCACTG -3'
(R):5'- GGATATAGAGCATCTCCATCTTCAGC -3'

Posted On

2013-06-11