Mutagenetix > Incidental Mutations

Incidental Mutation 'R5891:Gmcl1'

457175

Institutional Source

Beutler Lab

Gene Symbol

Gmcl1

Ensembl Gene

ENSMUSG00000001157

Gene Name

germ cell-less, spermatogenesis associated 1

Synonyms

Gcl, mglc-1, 2810049L19Rik

MMRRC Submission

044092-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.423) question?

Stock #

R5891 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86691768-86733383 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86707443 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 366 (W366R)

Ref Sequence

ENSEMBL: ENSMUSP00000001185 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001185]

Predicted Effect

probably damaging
Transcript: ENSMUST00000001185
AA Change: W366R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000001185
Gene: ENSMUSG00000001157
AA Change: W366R

Domain	Start	End	E-Value	Type
low complexity region	23	38	N/A	INTRINSIC
low complexity region	63	75	N/A	INTRINSIC
BTB	106	206	3.76e-11	SMART
BACK	211	298	3.6e-3	SMART

Meta Mutation Damage Score

0.9318

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.9%

Validation Efficiency

96% (85/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear envelope protein that appears to be involved in spermatogenesis, either directly or by influencing genes that play a more direct role in the process. This multi-exon locus is the homolog of the mouse and drosophila germ cell-less gene but the human genome also contains a single-exon locus on chromosome 5 that contains an open reading frame capable of encoding a highly-related protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired nuclear membrane integrity in liver, endocrine pancreas, and testis. Mutant males show reduced fertility with decreased chromatin condensation and morphologically abnormal sperm. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	A	G	15: 8,188,589	I828V	probably benign	Het
A430105I19Rik	T	A	2: 118,761,383	D92V	probably damaging	Het
Abi3bp	A	T	16: 56,606,133	T504S	probably damaging	Het
Adamtsl4	C	A	3: 95,682,313	R387L	possibly damaging	Het
Adgb	G	A	10: 10,377,847	Q1224*	probably null	Het
Ankrd40	T	A	11: 94,334,863	F240Y	probably damaging	Het
Asnsd1	A	T	1: 53,347,977	Y164N	probably benign	Het
Atf7ip	A	T	6: 136,559,977	E69D	possibly damaging	Het
Atm	T	C	9: 53,497,159	T1129A	probably benign	Het
AU021092	T	C	16: 5,212,131	D340G	probably benign	Het
Baz2a	T	A	10: 128,121,322	I978N	probably damaging	Het
BC034090	T	C	1: 155,233,047		probably benign	Het
Bcl9	A	G	3: 97,208,888	L830P	probably damaging	Het
Bicral	T	C	17: 46,801,229	N1015S	probably benign	Het
Ceacam3	C	A	7: 17,151,793	T107N	probably damaging	Het
Cep83	T	C	10: 94,725,675	V109A	probably benign	Het
Ces1e	A	G	8: 93,203,266	V463A	possibly damaging	Het
Ciao1	A	G	2: 127,247,134	V55A	probably benign	Het
Col19a1	T	C	1: 24,289,725	E900G	probably damaging	Het
Commd3	A	G	2: 18,673,815		probably benign	Het
Coro1c	A	G	5: 113,850,811	I157T	probably damaging	Het
Ctso	T	A	3: 81,954,254	F311L	probably benign	Het
Cxcl10	A	G	5: 92,348,224		probably benign	Het
Daam1	C	A	12: 71,944,149	T179N	unknown	Het
Ddx24	T	C	12: 103,424,058	K225E	probably damaging	Het
Dnajc16	T	C	4: 141,775,392	T278A	probably benign	Het
Dnajc2	A	T	5: 21,761,711	N345K	possibly damaging	Het
Dnpep	G	T	1: 75,311,812	Q395K	probably benign	Het
Dync1h1	T	C	12: 110,614,220		probably null	Het
Exoc1	A	G	5: 76,542,144	D177G	probably damaging	Het
Fam135b	C	T	15: 71,525,803	R136H	probably damaging	Het
Fam214a	C	G	9: 75,004,386	C46W	probably damaging	Het
Filip1	T	G	9: 79,819,860	L492F	possibly damaging	Het
Flvcr2	A	T	12: 85,796,228	I359F	possibly damaging	Het
Htt	A	G	5: 34,870,823	T1808A	possibly damaging	Het
Ighv5-4	C	A	12: 113,597,629	R57L	probably damaging	Het
Il12rb2	A	T	6: 67,360,690	I69N	probably damaging	Het
Irf5	A	T	6: 29,529,425		probably benign	Het
Kif13b	T	G	14: 64,788,405		probably null	Het
Klkb1	T	A	8: 45,270,666	T571S	probably benign	Het
Mapkbp1	G	T	2: 120,023,932	E1337*	probably null	Het
Met	A	G	6: 17,491,539	D100G	probably benign	Het
Mgam	T	A	6: 40,744,348	D183E	probably benign	Het
Mrgprb13	T	C	7: 48,312,259		noncoding transcript	Het
Mrgprx2	T	C	7: 48,482,246	T275A	probably benign	Het
Mroh2a	C	A	1: 88,241,615	Q671K	possibly damaging	Het
Nckipsd	T	A	9: 108,808,609	S42R	probably damaging	Het
Nlrp12	T	A	7: 3,219,259		probably benign	Het
Olfr1297	A	T	2: 111,621,433	L214M	probably damaging	Het
Olfr361	T	A	2: 37,084,978	M257L	probably benign	Het
Olfr467	C	T	7: 107,815,180	P199S	probably damaging	Het
Olfr527	C	T	7: 140,336,600	T246I	probably benign	Het
Otoa	T	A	7: 121,132,360		probably null	Het
Pfkm	T	A	15: 98,122,690	C233*	probably null	Het
Pikfyve	A	G	1: 65,202,737	Y212C	probably damaging	Het
Ptprq	T	A	10: 107,576,895	D1781V	possibly damaging	Het
Pttg1ip	A	G	10: 77,582,440		probably benign	Het
Rab6a	T	A	7: 100,639,247		probably null	Het
Rbm11	C	T	16: 75,598,837	A132V	possibly damaging	Het
Sept4	G	T	11: 87,588,924		probably benign	Het
Serpinb8	A	G	1: 107,605,845	E210G	probably damaging	Het
Sertad2	G	A	11: 20,647,884	G27S	probably benign	Het
Slco5a1	A	G	1: 12,990,402	F32L	probably benign	Het
Smad2	A	G	18: 76,299,975	E326G	probably damaging	Het
Sp9	T	A	2: 73,274,251	L383Q	probably damaging	Het
Stx11	T	C	10: 12,941,815	N55S	probably damaging	Het
Tbc1d15	T	A	10: 115,220,308	Q253L	probably benign	Het
Tcf7l1	T	A	6: 72,637,051		probably benign	Het
Tdrd9	T	A	12: 112,042,719	S1020T	probably damaging	Het
Tead3	A	T	17: 28,341,365	D88E	probably damaging	Het
Tnrc18	A	G	5: 142,815,171	S11P	probably damaging	Homo
Trpc3	G	T	3: 36,671,022	D268E	probably damaging	Het
Ttn	A	G	2: 76,745,741	V23190A	possibly damaging	Het
Ubr4	T	A	4: 139,408,626	Y908*	probably null	Het
Urb2	G	T	8: 124,030,856	V1101L	possibly damaging	Het
Usp9y	A	T	Y: 1,341,535	D1375E	probably benign	Het
Zcchc7	T	C	4: 44,895,838	L262P	probably damaging	Het
Zdhhc7	T	A	8: 120,084,900	H188L	probably benign	Het
Zfp518a	T	A	19: 40,912,433	C269S	probably damaging	Het
Zfp933	T	C	4: 147,826,774	K90E	probably benign	Het

Other mutations in Gmcl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02015:Gmcl1	APN	6	86707457	missense	possibly damaging	0.52
IGL03354:Gmcl1	APN	6	86726158	missense	probably damaging	1.00
PIT4453001:Gmcl1	UTSW	6	86704538	missense	probably benign	0.09
R0149:Gmcl1	UTSW	6	86732909	critical splice donor site	probably null
R1398:Gmcl1	UTSW	6	86714262	splice site	probably benign
R1869:Gmcl1	UTSW	6	86697516	missense	probably benign	0.20
R1871:Gmcl1	UTSW	6	86697516	missense	probably benign	0.20
R2851:Gmcl1	UTSW	6	86726177	missense	probably damaging	0.99
R4584:Gmcl1	UTSW	6	86722623	missense	probably damaging	1.00
R4585:Gmcl1	UTSW	6	86722623	missense	probably damaging	1.00
R4664:Gmcl1	UTSW	6	86732998	missense	probably benign	0.30
R4851:Gmcl1	UTSW	6	86704556	missense	possibly damaging	0.64
R4957:Gmcl1	UTSW	6	86710521	missense	probably damaging	1.00
R5326:Gmcl1	UTSW	6	86726145	missense	possibly damaging	0.96
R5482:Gmcl1	UTSW	6	86718073	missense	probably damaging	1.00
R5496:Gmcl1	UTSW	6	86697525	missense	probably damaging	0.97
R5817:Gmcl1	UTSW	6	86714248	missense	probably damaging	1.00
R5854:Gmcl1	UTSW	6	86714259	splice site	silent
R5895:Gmcl1	UTSW	6	86711614	missense	probably benign	0.03
R6012:Gmcl1	UTSW	6	86721412	missense	probably damaging	1.00
R6257:Gmcl1	UTSW	6	86700641	missense	possibly damaging	0.82
R7693:Gmcl1	UTSW	6	86714257	missense	probably benign	0.10
R7698:Gmcl1	UTSW	6	86707415	missense	probably benign	0.00
R7999:Gmcl1	UTSW	6	86721426	missense	probably damaging	1.00
R8049:Gmcl1	UTSW	6	86721426	missense	probably damaging	1.00
R8093:Gmcl1	UTSW	6	86721426	missense	probably damaging	1.00
R8109:Gmcl1	UTSW	6	86721426	missense	probably damaging	1.00
R8110:Gmcl1	UTSW	6	86721426	missense	probably damaging	1.00
R8111:Gmcl1	UTSW	6	86721426	missense	probably damaging	1.00
R8154:Gmcl1	UTSW	6	86721426	missense	probably damaging	1.00
R8157:Gmcl1	UTSW	6	86721426	missense	probably damaging	1.00
R8208:Gmcl1	UTSW	6	86721399	missense	probably damaging	0.99
R8250:Gmcl1	UTSW	6	86721402	missense	possibly damaging	0.72
R8509:Gmcl1	UTSW	6	86722607	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTTAGTTATTCCTAAGTGGCTCCAC -3'
(R):5'- GTCACATTGTTAACAACCTGCTTTG -3'

Sequencing Primer
(F):5'- TAGGGTGAAGGTTCAAGC -3'
(R):5'- CAGGCAGATTTCTGAGTTCGAAGC -3'

Posted On

2017-02-15