Incidental Mutation 'R0558:Rsph10b'
ID45720
Institutional Source Beutler Lab
Gene Symbol Rsph10b
Ensembl Gene ENSMUSG00000075569
Gene Nameradial spoke head 10 homolog B (Chlamydomonas)
SynonymsRsph10b2, 4930526H21Rik
MMRRC Submission 038750-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R0558 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location143933035-143985719 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 143949338 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 285 (I285L)
Ref Sequence ENSEMBL: ENSMUSP00000132687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166847] [ENSMUST00000169758]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000031618
Predicted Effect probably benign
Transcript: ENSMUST00000166847
AA Change: I285L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000132687
Gene: ENSMUSG00000075569
AA Change: I285L

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
low complexity region 63 75 N/A INTRINSIC
MORN 107 128 5.9e-7 SMART
MORN 130 151 9.35e-1 SMART
MORN 153 174 1.23e0 SMART
MORN 177 198 1.84e0 SMART
MORN 202 223 3.21e1 SMART
MORN 225 246 1.67e-6 SMART
MORN 249 270 1.85e1 SMART
MORN 282 303 2.71e-6 SMART
MORN 305 326 3.53e-5 SMART
low complexity region 409 420 N/A INTRINSIC
low complexity region 629 649 N/A INTRINSIC
coiled coil region 787 841 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167009
Predicted Effect probably benign
Transcript: ENSMUST00000169758
SMART Domains Protein: ENSMUSP00000127770
Gene: ENSMUSG00000075569

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
low complexity region 63 75 N/A INTRINSIC
Blast:MORN 84 105 7e-6 BLAST
MORN 107 128 5.9e-7 SMART
MORN 130 151 9.35e-1 SMART
MORN 153 174 1.23e0 SMART
Pfam:MORN 179 191 2.3e-2 PFAM
Meta Mutation Damage Score 0.1605 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (80/80)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik T C 17: 25,947,549 N338S probably benign Het
Abcc2 G A 19: 43,800,724 G273R probably benign Het
Adamts10 T C 17: 33,550,609 V935A probably benign Het
Anapc15-ps T C 10: 95,673,121 D90G probably damaging Het
Atic T A 1: 71,563,788 V107E probably benign Het
Atp4b T C 8: 13,393,523 T52A possibly damaging Het
Cacna1h C T 17: 25,381,550 A1606T probably damaging Het
Cacng6 T A 7: 3,434,808 Y217* probably null Het
Cc2d2a T G 5: 43,724,387 probably benign Het
Cd226 T A 18: 89,207,214 H78Q probably benign Het
Cers3 A G 7: 66,783,418 D161G probably damaging Het
Ces1f T C 8: 93,275,389 H37R probably benign Het
Chek1 T A 9: 36,712,115 N421I possibly damaging Het
Cma2 T C 14: 55,972,792 Y45H probably damaging Het
Cmas C A 6: 142,775,244 Y401* probably null Het
Cyp2j8 A T 4: 96,444,634 S492T probably benign Het
Dnah12 T C 14: 26,709,310 S358P probably benign Het
Dnajc13 T C 9: 104,201,952 probably null Het
Ep400 A C 5: 110,685,067 probably benign Het
Fam209 T A 2: 172,472,838 N82K probably benign Het
Fam92a T C 4: 12,164,095 D248G probably damaging Het
G3bp2 A T 5: 92,073,197 Y20N probably damaging Het
Gli2 T C 1: 118,837,649 D924G probably benign Het
Gm10787 T C 10: 77,022,016 noncoding transcript Het
Gm11568 A G 11: 99,858,046 R26G unknown Het
Gm4788 A G 1: 139,739,492 V376A probably damaging Het
Hivep3 T G 4: 120,096,566 L693R probably damaging Het
Hook1 A G 4: 95,993,212 probably benign Het
Ibtk A C 9: 85,737,538 D116E probably damaging Het
Insrr C T 3: 87,810,981 T927I possibly damaging Het
Irx1 T G 13: 71,959,628 S312R probably benign Het
Itga11 T C 9: 62,752,288 Y441H probably benign Het
Itsn1 A G 16: 91,899,623 D38G possibly damaging Het
Kat6b G T 14: 21,669,421 E1280D probably benign Het
Kcnk10 T A 12: 98,436,301 Y293F possibly damaging Het
Krt74 T A 15: 101,760,963 noncoding transcript Het
Lars T G 18: 42,214,837 I974L probably benign Het
Limch1 A G 5: 66,969,155 D42G probably damaging Het
Mau2 G C 8: 70,042,432 T85R probably damaging Het
Mkrn3 A G 7: 62,418,864 I393T probably benign Het
Mpl A C 4: 118,444,020 S541R probably damaging Het
Nfrkb T C 9: 31,410,268 S754P possibly damaging Het
Olfr1170 A G 2: 88,224,474 V186A possibly damaging Het
Olfr1233 A G 2: 89,340,236 L22P probably benign Het
Olfr1350 T C 7: 6,570,653 Y221H possibly damaging Het
Olfr1537 T A 9: 39,238,200 T75S probably damaging Het
P2rx7 A T 5: 122,673,798 I391F possibly damaging Het
Pbrm1 T A 14: 31,085,059 probably null Het
Pcdh8 T C 14: 79,770,076 D349G probably damaging Het
Pias1 A G 9: 62,882,009 S639P possibly damaging Het
Pkhd1l1 A T 15: 44,484,424 I232F probably damaging Het
Plxnc1 C T 10: 94,837,935 R995Q probably damaging Het
Pnliprp2 T A 19: 58,774,087 S375T probably benign Het
Prkar1b C T 5: 139,020,092 V313M probably benign Het
Ptpn13 T C 5: 103,529,717 S734P probably damaging Het
Rdh1 T C 10: 127,759,941 W2R possibly damaging Het
Rubcnl T C 14: 75,047,547 F502S probably damaging Het
Ryr2 T A 13: 11,638,443 I3693F probably damaging Het
Ryr2 T C 13: 11,799,861 Y675C probably damaging Het
Scaper T C 9: 55,685,923 T477A probably benign Het
Scn2a G T 2: 65,711,925 V791L probably benign Het
Sdk1 A T 5: 142,132,065 T1573S probably damaging Het
Sema3c A T 5: 17,714,415 H483L probably benign Het
Sema6c T C 3: 95,168,691 S219P probably damaging Het
Slc10a5 T G 3: 10,335,117 E161A probably damaging Het
Slc22a23 C T 13: 34,344,383 G139S possibly damaging Het
Slc34a3 C T 2: 25,233,065 probably benign Het
Slc38a9 A T 13: 112,729,196 probably null Het
Taok1 A C 11: 77,559,844 S367R possibly damaging Het
Tlr6 G A 5: 64,954,860 Q235* probably null Het
Top2a A G 11: 98,996,839 V1281A probably benign Het
Tpgs1 T C 10: 79,675,782 Y253H probably damaging Het
Tubgcp3 T C 8: 12,653,462 T288A probably benign Het
Ubr4 A G 4: 139,426,902 E2140G probably benign Het
Uso1 A G 5: 92,174,019 Q257R probably benign Het
Zfp106 A G 2: 120,532,196 V48A probably damaging Het
Zfp174 T A 16: 3,848,254 S128T possibly damaging Het
Zscan26 T A 13: 21,445,055 D426V probably benign Het
Other mutations in Rsph10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rsph10b APN 5 143937087 makesense probably null
K7894:Rsph10b UTSW 5 143944520 missense probably damaging 1.00
R0136:Rsph10b UTSW 5 143959821 missense probably benign 0.05
R0149:Rsph10b UTSW 5 143938909 unclassified probably benign
R0326:Rsph10b UTSW 5 143967128 missense probably damaging 1.00
R1185:Rsph10b UTSW 5 143966462 splice site probably benign
R1185:Rsph10b UTSW 5 143966462 splice site probably benign
R1712:Rsph10b UTSW 5 143937149 missense probably damaging 0.96
R1832:Rsph10b UTSW 5 143967179 missense possibly damaging 0.79
R1909:Rsph10b UTSW 5 143985491 missense probably benign 0.09
R2044:Rsph10b UTSW 5 143967250 splice site probably null
R2155:Rsph10b UTSW 5 143961256 missense probably benign 0.05
R2842:Rsph10b UTSW 5 143979892 missense possibly damaging 0.81
R3805:Rsph10b UTSW 5 143958388 critical splice donor site probably null
R4031:Rsph10b UTSW 5 143985668 splice site probably null
R4792:Rsph10b UTSW 5 143937317 missense probably damaging 1.00
R4866:Rsph10b UTSW 5 143948529 missense probably benign 0.28
R6090:Rsph10b UTSW 5 143977128 missense probably benign 0.00
R6252:Rsph10b UTSW 5 143937121 missense possibly damaging 0.70
R6255:Rsph10b UTSW 5 143959746 missense probably damaging 1.00
R6518:Rsph10b UTSW 5 143963873 missense probably damaging 1.00
R7085:Rsph10b UTSW 5 143949284 missense possibly damaging 0.82
R7206:Rsph10b UTSW 5 143961192 missense possibly damaging 0.86
R7337:Rsph10b UTSW 5 143961215 missense probably benign 0.11
R7353:Rsph10b UTSW 5 143967220 missense possibly damaging 0.73
R7567:Rsph10b UTSW 5 143949426 missense possibly damaging 0.78
R8022:Rsph10b UTSW 5 143967232 missense probably benign 0.00
R8109:Rsph10b UTSW 5 143985530 missense probably benign 0.00
R8275:Rsph10b UTSW 5 143966505 missense possibly damaging 0.50
Z1177:Rsph10b UTSW 5 143977134 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTACAATCCCTAAAGGGCTCACTGC -3'
(R):5'- TGGCATAGACATGCTGAAGTCACTG -3'

Sequencing Primer
(F):5'- CTAAAGGGCTCACTGCCAGAG -3'
(R):5'- TATGAACGATCAGGCTACACTG -3'
Posted On2013-06-11