Incidental Mutation 'R5891:Baz2a'
ID457201
Institutional Source Beutler Lab
Gene Symbol Baz2a
Ensembl Gene ENSMUSG00000040054
Gene Namebromodomain adjacent to zinc finger domain, 2A
SynonymsC030005G16Rik, Tip5, Walp3
MMRRC Submission 044092-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5891 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128091577-128129303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 128121322 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 978 (I978N)
Ref Sequence ENSEMBL: ENSMUSP00000151961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045621] [ENSMUST00000170054] [ENSMUST00000217851] [ENSMUST00000219072] [ENSMUST00000220049]
Predicted Effect probably damaging
Transcript: ENSMUST00000045621
AA Change: I978N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044359
Gene: ENSMUSG00000040054
AA Change: I978N

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
low complexity region 342 353 N/A INTRINSIC
low complexity region 421 475 N/A INTRINSIC
low complexity region 518 529 N/A INTRINSIC
MBD 539 614 3.87e-35 SMART
AT_hook 639 651 2.38e0 SMART
AT_hook 660 672 1.65e0 SMART
low complexity region 697 710 N/A INTRINSIC
coiled coil region 736 776 N/A INTRINSIC
DDT 837 902 3.75e-18 SMART
Pfam:WHIM1 939 988 4.8e-8 PFAM
low complexity region 1001 1013 N/A INTRINSIC
AT_hook 1174 1186 6.23e1 SMART
AT_hook 1388 1400 4.21e0 SMART
Pfam:WHIM3 1423 1464 1e-9 PFAM
PHD 1662 1708 1.47e-11 SMART
low complexity region 1741 1753 N/A INTRINSIC
BROMO 1773 1881 7.71e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170054
AA Change: I979N

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129803
Gene: ENSMUSG00000040054
AA Change: I979N

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
low complexity region 343 354 N/A INTRINSIC
low complexity region 422 476 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
MBD 540 615 3.87e-35 SMART
AT_hook 640 652 2.38e0 SMART
AT_hook 661 673 1.65e0 SMART
low complexity region 698 711 N/A INTRINSIC
coiled coil region 737 777 N/A INTRINSIC
DDT 838 903 3.75e-18 SMART
Pfam:WHIM1 940 989 4.8e-8 PFAM
low complexity region 1002 1014 N/A INTRINSIC
AT_hook 1175 1187 6.23e1 SMART
AT_hook 1389 1401 4.21e0 SMART
Pfam:WHIM3 1424 1462 5.5e-19 PFAM
PHD 1663 1709 1.47e-11 SMART
low complexity region 1742 1754 N/A INTRINSIC
BROMO 1774 1882 7.71e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000217851
AA Change: I981N

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218772
Predicted Effect probably benign
Transcript: ENSMUST00000219072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219980
Predicted Effect probably damaging
Transcript: ENSMUST00000220049
AA Change: I978N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.2651 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 96% (85/89)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,188,589 I828V probably benign Het
A430105I19Rik T A 2: 118,761,383 D92V probably damaging Het
Abi3bp A T 16: 56,606,133 T504S probably damaging Het
Adamtsl4 C A 3: 95,682,313 R387L possibly damaging Het
Adgb G A 10: 10,377,847 Q1224* probably null Het
Ankrd40 T A 11: 94,334,863 F240Y probably damaging Het
Asnsd1 A T 1: 53,347,977 Y164N probably benign Het
Atf7ip A T 6: 136,559,977 E69D possibly damaging Het
Atm T C 9: 53,497,159 T1129A probably benign Het
AU021092 T C 16: 5,212,131 D340G probably benign Het
BC034090 T C 1: 155,233,047 probably benign Het
Bcl9 A G 3: 97,208,888 L830P probably damaging Het
Bicral T C 17: 46,801,229 N1015S probably benign Het
Ceacam3 C A 7: 17,151,793 T107N probably damaging Het
Cep83 T C 10: 94,725,675 V109A probably benign Het
Ces1e A G 8: 93,203,266 V463A possibly damaging Het
Ciao1 A G 2: 127,247,134 V55A probably benign Het
Col19a1 T C 1: 24,289,725 E900G probably damaging Het
Commd3 A G 2: 18,673,815 probably benign Het
Coro1c A G 5: 113,850,811 I157T probably damaging Het
Ctso T A 3: 81,954,254 F311L probably benign Het
Cxcl10 A G 5: 92,348,224 probably benign Het
Daam1 C A 12: 71,944,149 T179N unknown Het
Ddx24 T C 12: 103,424,058 K225E probably damaging Het
Dnajc16 T C 4: 141,775,392 T278A probably benign Het
Dnajc2 A T 5: 21,761,711 N345K possibly damaging Het
Dnpep G T 1: 75,311,812 Q395K probably benign Het
Dync1h1 T C 12: 110,614,220 probably null Het
Exoc1 A G 5: 76,542,144 D177G probably damaging Het
Fam135b C T 15: 71,525,803 R136H probably damaging Het
Fam214a C G 9: 75,004,386 C46W probably damaging Het
Filip1 T G 9: 79,819,860 L492F possibly damaging Het
Flvcr2 A T 12: 85,796,228 I359F possibly damaging Het
Gmcl1 A G 6: 86,707,443 W366R probably damaging Het
Htt A G 5: 34,870,823 T1808A possibly damaging Het
Ighv5-4 C A 12: 113,597,629 R57L probably damaging Het
Il12rb2 A T 6: 67,360,690 I69N probably damaging Het
Irf5 A T 6: 29,529,425 probably benign Het
Kif13b T G 14: 64,788,405 probably null Het
Klkb1 T A 8: 45,270,666 T571S probably benign Het
Mapkbp1 G T 2: 120,023,932 E1337* probably null Het
Met A G 6: 17,491,539 D100G probably benign Het
Mgam T A 6: 40,744,348 D183E probably benign Het
Mrgprb13 T C 7: 48,312,259 noncoding transcript Het
Mrgprx2 T C 7: 48,482,246 T275A probably benign Het
Mroh2a C A 1: 88,241,615 Q671K possibly damaging Het
Nckipsd T A 9: 108,808,609 S42R probably damaging Het
Nlrp12 T A 7: 3,219,259 probably benign Het
Olfr1297 A T 2: 111,621,433 L214M probably damaging Het
Olfr361 T A 2: 37,084,978 M257L probably benign Het
Olfr467 C T 7: 107,815,180 P199S probably damaging Het
Olfr527 C T 7: 140,336,600 T246I probably benign Het
Otoa T A 7: 121,132,360 probably null Het
Pfkm T A 15: 98,122,690 C233* probably null Het
Pikfyve A G 1: 65,202,737 Y212C probably damaging Het
Ptprq T A 10: 107,576,895 D1781V possibly damaging Het
Pttg1ip A G 10: 77,582,440 probably benign Het
Rab6a T A 7: 100,639,247 probably null Het
Rbm11 C T 16: 75,598,837 A132V possibly damaging Het
Sept4 G T 11: 87,588,924 probably benign Het
Serpinb8 A G 1: 107,605,845 E210G probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Slco5a1 A G 1: 12,990,402 F32L probably benign Het
Smad2 A G 18: 76,299,975 E326G probably damaging Het
Sp9 T A 2: 73,274,251 L383Q probably damaging Het
Stx11 T C 10: 12,941,815 N55S probably damaging Het
Tbc1d15 T A 10: 115,220,308 Q253L probably benign Het
Tcf7l1 T A 6: 72,637,051 probably benign Het
Tdrd9 T A 12: 112,042,719 S1020T probably damaging Het
Tead3 A T 17: 28,341,365 D88E probably damaging Het
Tnrc18 A G 5: 142,815,171 S11P probably damaging Homo
Trpc3 G T 3: 36,671,022 D268E probably damaging Het
Ttn A G 2: 76,745,741 V23190A possibly damaging Het
Ubr4 T A 4: 139,408,626 Y908* probably null Het
Urb2 G T 8: 124,030,856 V1101L possibly damaging Het
Usp9y A T Y: 1,341,535 D1375E probably benign Het
Zcchc7 T C 4: 44,895,838 L262P probably damaging Het
Zdhhc7 T A 8: 120,084,900 H188L probably benign Het
Zfp518a T A 19: 40,912,433 C269S probably damaging Het
Zfp933 T C 4: 147,826,774 K90E probably benign Het
Other mutations in Baz2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Baz2a APN 10 128124935 missense probably benign 0.00
IGL00501:Baz2a APN 10 128114625 missense probably benign 0.14
IGL00743:Baz2a APN 10 128114526 missense probably benign
IGL01362:Baz2a APN 10 128121964 missense probably damaging 0.98
IGL01394:Baz2a APN 10 128118645 missense possibly damaging 0.46
IGL01603:Baz2a APN 10 128111168 missense probably damaging 0.98
IGL02165:Baz2a APN 10 128119349 missense probably benign 0.03
IGL02732:Baz2a APN 10 128125175 missense possibly damaging 0.66
IGL03030:Baz2a APN 10 128125146 missense possibly damaging 0.62
IGL03087:Baz2a APN 10 128122313 missense probably damaging 0.99
R0255:Baz2a UTSW 10 128114639 missense possibly damaging 0.66
R0737:Baz2a UTSW 10 128116080 missense possibly damaging 0.92
R0742:Baz2a UTSW 10 128113666 nonsense probably null
R0755:Baz2a UTSW 10 128119691 missense possibly damaging 0.92
R0798:Baz2a UTSW 10 128126323 splice site probably benign
R0879:Baz2a UTSW 10 128121304 missense probably damaging 0.99
R1023:Baz2a UTSW 10 128121807 missense possibly damaging 0.66
R1482:Baz2a UTSW 10 128109008 missense possibly damaging 0.92
R1512:Baz2a UTSW 10 128124152 missense possibly damaging 0.95
R1658:Baz2a UTSW 10 128124383 missense probably benign 0.04
R1983:Baz2a UTSW 10 128123959 missense probably benign 0.14
R2059:Baz2a UTSW 10 128113578 missense probably damaging 0.98
R2141:Baz2a UTSW 10 128123612 missense probably damaging 1.00
R2921:Baz2a UTSW 10 128125077 frame shift probably null
R2922:Baz2a UTSW 10 128125077 frame shift probably null
R3104:Baz2a UTSW 10 128125077 frame shift probably null
R3105:Baz2a UTSW 10 128125077 frame shift probably null
R3106:Baz2a UTSW 10 128125077 frame shift probably null
R3621:Baz2a UTSW 10 128125077 frame shift probably null
R3872:Baz2a UTSW 10 128124110 missense probably damaging 1.00
R3873:Baz2a UTSW 10 128124110 missense probably damaging 1.00
R3875:Baz2a UTSW 10 128124110 missense probably damaging 1.00
R4600:Baz2a UTSW 10 128121183 missense probably damaging 0.97
R4692:Baz2a UTSW 10 128124893 missense probably damaging 1.00
R4717:Baz2a UTSW 10 128124942 missense possibly damaging 0.83
R4821:Baz2a UTSW 10 128111109 missense probably damaging 1.00
R4832:Baz2a UTSW 10 128123130 missense probably benign 0.08
R4893:Baz2a UTSW 10 128123415 missense possibly damaging 0.66
R4907:Baz2a UTSW 10 128110808 missense probably damaging 0.99
R5133:Baz2a UTSW 10 128116126 missense probably damaging 1.00
R5340:Baz2a UTSW 10 128115042 missense probably damaging 1.00
R5527:Baz2a UTSW 10 128124917 missense probably damaging 1.00
R5761:Baz2a UTSW 10 128119690 missense possibly damaging 0.66
R6088:Baz2a UTSW 10 128114642 small deletion probably benign
R6089:Baz2a UTSW 10 128114642 small deletion probably benign
R6323:Baz2a UTSW 10 128126417 missense probably benign 0.21
R6894:Baz2a UTSW 10 128123581 missense possibly damaging 0.81
R7101:Baz2a UTSW 10 128121187 missense possibly damaging 0.66
R7178:Baz2a UTSW 10 128124457 missense probably damaging 0.98
R7179:Baz2a UTSW 10 128124457 missense probably damaging 0.98
R7202:Baz2a UTSW 10 128118559 missense possibly damaging 0.54
R7223:Baz2a UTSW 10 128112606 missense probably damaging 1.00
R7268:Baz2a UTSW 10 128124221 missense possibly damaging 0.66
R7426:Baz2a UTSW 10 128116078 missense probably damaging 1.00
R7464:Baz2a UTSW 10 128122073 missense possibly damaging 0.81
R7568:Baz2a UTSW 10 128125270 missense possibly damaging 0.83
R7672:Baz2a UTSW 10 128123857 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CAGTCCCTGAAGATATTGGGG -3'
(R):5'- GAGCTGTAGGGATGGATCTCAG -3'

Sequencing Primer
(F):5'- GATGTCAGAGATCCCATTGACCAG -3'
(R):5'- GGGATGGATCTCAGTCTAGTTCAAAC -3'
Posted On2017-02-15