Incidental Mutation 'R5892:Fam107b'
ID457228
Institutional Source Beutler Lab
Gene Symbol Fam107b
Ensembl Gene ENSMUSG00000026655
Gene Namefamily with sequence similarity 107, member B
Synonyms
MMRRC Submission 044093-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5892 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location3570488-3782142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3778564 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 268 (E268G)
Ref Sequence ENSEMBL: ENSMUSP00000154419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027965] [ENSMUST00000115052] [ENSMUST00000115053] [ENSMUST00000115054] [ENSMUST00000115055] [ENSMUST00000176254] [ENSMUST00000177125] [ENSMUST00000226435]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027965
AA Change: E92G

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027965
Gene: ENSMUSG00000026655
AA Change: E92G

DomainStartEndE-ValueType
Pfam:DUF1151 1 120 3.9e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115052
AA Change: E114G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110704
Gene: ENSMUSG00000026655
AA Change: E114G

DomainStartEndE-ValueType
Pfam:DUF1151 29 142 3.4e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115053
AA Change: E92G

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110705
Gene: ENSMUSG00000026655
AA Change: E92G

DomainStartEndE-ValueType
Pfam:DUF1151 1 120 3.9e-54 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115054
AA Change: E92G

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110706
Gene: ENSMUSG00000026655
AA Change: E92G

DomainStartEndE-ValueType
Pfam:DUF1151 1 120 3.9e-54 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115055
AA Change: E92G

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110707
Gene: ENSMUSG00000026655
AA Change: E92G

DomainStartEndE-ValueType
Pfam:DUF1151 1 120 3.9e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176254
AA Change: E36G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135846
Gene: ENSMUSG00000026655
AA Change: E36G

DomainStartEndE-ValueType
Pfam:DUF1151 1 64 2.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177125
Predicted Effect probably damaging
Transcript: ENSMUST00000226435
AA Change: E268G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.3633 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 98% (56/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik G T 5: 99,979,265 probably benign Het
Abcb11 C T 2: 69,261,500 A893T probably damaging Het
Adtrp A T 13: 41,828,206 N30K probably benign Het
Alms1 T A 6: 85,620,903 S904T probably damaging Het
Cep170 T A 1: 176,755,387 probably null Het
Cntnap3 A G 13: 64,799,180 V145A probably damaging Het
Dclre1a T C 19: 56,547,140 E4G probably benign Het
Depdc1a G C 3: 159,526,669 A686P probably damaging Het
Dnah7b T C 1: 46,337,593 probably null Het
Enox1 A G 14: 77,486,017 probably benign Het
Fer1l6 A G 15: 58,564,068 S437G probably benign Het
Flnb C A 14: 7,907,183 T1252K probably damaging Het
Fubp1 A G 3: 152,218,314 probably benign Het
Gm20402 G A 3: 52,268,949 A50T probably benign Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gzmk C T 13: 113,173,922 probably null Het
Ino80 A T 2: 119,439,547 probably benign Het
Ints8 T C 4: 11,223,813 T677A probably damaging Het
Kat6a A G 8: 22,938,289 E1220G probably damaging Het
Lrfn5 A G 12: 61,843,418 T498A probably damaging Het
Lrp2 T A 2: 69,442,776 T4043S probably benign Het
Malrd1 A G 2: 15,614,267 N314S probably benign Het
Mfsd1 A G 3: 67,589,829 probably null Het
Muc1 C T 3: 89,230,993 P381S probably benign Het
Myh2 A T 11: 67,185,176 K730* probably null Het
Nat3 T A 8: 67,547,938 N156K probably benign Het
Nelfe T C 17: 34,854,669 probably benign Het
Nlrp1a A T 11: 71,099,645 L927Q probably damaging Het
P4ha2 A G 11: 54,120,188 Y343C probably damaging Het
Pclo A T 5: 14,521,171 Q190L probably damaging Het
Pde8a A G 7: 81,295,691 N183S probably damaging Het
Plekha2 C T 8: 25,052,365 V278I probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plxnb1 T C 9: 109,111,707 L1550P probably damaging Het
Ppox C T 1: 171,277,461 V385I probably damaging Het
Prdm16 T C 4: 154,323,259 D1170G possibly damaging Het
Prmt5 A T 14: 54,509,911 S470T probably damaging Het
Robo2 T A 16: 73,895,780 probably benign Het
Siglecg G A 7: 43,412,204 probably benign Het
Slc30a5 T C 13: 100,813,302 N367S probably damaging Het
Tex29 C T 8: 11,854,288 probably benign Het
Tmem117 T A 15: 94,638,139 V18E probably damaging Het
Tmtc2 C T 10: 105,413,505 M122I probably benign Het
Tpr T A 1: 150,407,400 N287K probably benign Het
Unc93b1 A T 19: 3,943,632 D358V probably damaging Het
Vrk2 A T 11: 26,534,372 probably benign Het
Wdr24 A T 17: 25,827,986 Q671L probably benign Het
Zfp110 C T 7: 12,848,478 T351I probably benign Het
Zfp963 T C 8: 69,743,377 D142G probably benign Het
Other mutations in Fam107b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01537:Fam107b APN 2 3778528 missense probably damaging 1.00
IGL03377:Fam107b APN 2 3778444 missense probably damaging 1.00
R4021:Fam107b UTSW 2 3778474 missense probably damaging 1.00
R4234:Fam107b UTSW 2 3770740 missense possibly damaging 0.67
R4841:Fam107b UTSW 2 3778543 missense probably damaging 1.00
R4842:Fam107b UTSW 2 3778543 missense probably damaging 1.00
R4938:Fam107b UTSW 2 3772870 missense probably benign 0.00
R5557:Fam107b UTSW 2 3770754 nonsense probably null
R5754:Fam107b UTSW 2 3778420 missense probably damaging 1.00
R5996:Fam107b UTSW 2 3779630 unclassified probably null
R7634:Fam107b UTSW 2 3770740 missense possibly damaging 0.67
R7652:Fam107b UTSW 2 3772847 missense probably benign 0.00
R7664:Fam107b UTSW 2 3570710 missense probably damaging 0.98
R7672:Fam107b UTSW 2 3772922 missense probably damaging 1.00
X0027:Fam107b UTSW 2 3778467 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCAGCTCATACCTTCAG -3'
(R):5'- ATGGGATGTACACCCTCCAC -3'

Sequencing Primer
(F):5'- TCCTGAGAGATACTTCCAGTGAG -3'
(R):5'- TGTCTCTCTCAGGGAGCG -3'
Posted On2017-02-15