Mutagenetix > Incidental Mutation

Incidental Mutation 'R5892:Malrd1'

457229

Institutional Source

Beutler Lab

Gene Symbol

Malrd1

Ensembl Gene

ENSMUSG00000075520

Gene Name

MAM and LDL receptor class A domain containing 1

Synonyms

Diet1, Gm13364, Gm13318

MMRRC Submission

044093-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R5892 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

15526479-16255555 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 15614267 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 314 (N314S)

Ref Sequence

ENSEMBL: ENSMUSP00000116869 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000146205]

AlphaFold

A2AJX4

Predicted Effect

probably benign
Transcript: ENSMUST00000146205
AA Change: N314S

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000116869
Gene: ENSMUSG00000075520
AA Change: N314S

Domain	Start	End	E-Value	Type
Pfam:MAM	8	171	1.6e-36	PFAM
LDLa	181	219	6.89e-8	SMART
LDLa	225	262	4.37e-10	SMART
LDLa	264	303	9.55e-3	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.6%

Validation Efficiency

98% (56/57)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930524J08Rik	G	T	5: 99,979,265		probably benign	Het
Abcb11	C	T	2: 69,261,500	A893T	probably damaging	Het
Adtrp	A	T	13: 41,828,206	N30K	probably benign	Het
Alms1	T	A	6: 85,620,903	S904T	probably damaging	Het
Cep170	T	A	1: 176,755,387		probably null	Het
Cntnap3	A	G	13: 64,799,180	V145A	probably damaging	Het
Dclre1a	T	C	19: 56,547,140	E4G	probably benign	Het
Depdc1a	G	C	3: 159,526,669	A686P	probably damaging	Het
Dnah7b	T	C	1: 46,337,593		probably null	Het
Enox1	A	G	14: 77,486,017		probably benign	Het
Fam107b	A	G	2: 3,778,564	E268G	probably damaging	Het
Fer1l6	A	G	15: 58,564,068	S437G	probably benign	Het
Flnb	C	A	14: 7,907,183	T1252K	probably damaging	Het
Fubp1	A	G	3: 152,218,314		probably benign	Het
Gm20402	G	A	3: 52,268,949	A50T	probably benign	Het
Gpr137b	T	C	13: 13,359,406	Y355C		Het
Gzmk	C	T	13: 113,173,922		probably null	Het
Ino80	A	T	2: 119,439,547		probably benign	Het
Ints8	T	C	4: 11,223,813	T677A	probably damaging	Het
Kat6a	A	G	8: 22,938,289	E1220G	probably damaging	Het
Lrfn5	A	G	12: 61,843,418	T498A	probably damaging	Het
Lrp2	T	A	2: 69,442,776	T4043S	probably benign	Het
Mfsd1	A	G	3: 67,589,829		probably null	Het
Muc1	C	T	3: 89,230,993	P381S	probably benign	Het
Myh2	A	T	11: 67,185,176	K730*	probably null	Het
Nat3	T	A	8: 67,547,938	N156K	probably benign	Het
Nelfe	T	C	17: 34,854,669		probably benign	Het
Nlrp1a	A	T	11: 71,099,645	L927Q	probably damaging	Het
P4ha2	A	G	11: 54,120,188	Y343C	probably damaging	Het
Pclo	A	T	5: 14,521,171	Q190L	probably damaging	Het
Pde8a	A	G	7: 81,295,691	N183S	probably damaging	Het
Plekha2	C	T	8: 25,052,365	V278I	probably benign	Het
Plekha6	G	C	1: 133,272,307	R208P	possibly damaging	Het
Plxnb1	T	C	9: 109,111,707	L1550P	probably damaging	Het
Ppox	C	T	1: 171,277,461	V385I	probably damaging	Het
Prdm16	T	C	4: 154,323,259	D1170G	possibly damaging	Het
Prmt5	A	T	14: 54,509,911	S470T	probably damaging	Het
Robo2	T	A	16: 73,895,780		probably benign	Het
Siglecg	G	A	7: 43,412,204		probably benign	Het
Slc30a5	T	C	13: 100,813,302	N367S	probably damaging	Het
Tex29	C	T	8: 11,854,288		probably benign	Het
Tmem117	T	A	15: 94,638,139	V18E	probably damaging	Het
Tmtc2	C	T	10: 105,413,505	M122I	probably benign	Het
Tpr	T	A	1: 150,407,400	N287K	probably benign	Het
Unc93b1	A	T	19: 3,943,632	D358V	probably damaging	Het
Vrk2	A	T	11: 26,534,372		probably benign	Het
Wdr24	A	T	17: 25,827,986	Q671L	probably benign	Het
Zfp110	C	T	7: 12,848,478	T351I	probably benign	Het
Zfp963	T	C	8: 69,743,377	D142G	probably benign	Het

Other mutations in Malrd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Malrd1	APN	2	16142186	splice site	probably benign
IGL01295:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01296:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01399:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01400:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01401:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01402:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01405:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01406:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL02105:Malrd1	APN	2	16127863	missense	unknown
IGL02581:Malrd1	APN	2	16142312	nonsense	probably null
IGL03015:Malrd1	APN	2	16042271	missense	unknown
IGL03038:Malrd1	APN	2	16127967	missense	unknown
R1353:Malrd1	UTSW	2	16127968	missense	unknown
R1385:Malrd1	UTSW	2	16042228	missense	unknown
R2242:Malrd1	UTSW	2	16101944	missense	unknown
R2888:Malrd1	UTSW	2	16074757	missense	unknown
R4398:Malrd1	UTSW	2	16150783	missense	unknown
R4982:Malrd1	UTSW	2	16042129	missense	probably benign	0.29
R5148:Malrd1	UTSW	2	16142226	missense	unknown
R5195:Malrd1	UTSW	2	16150810	missense	unknown
R5828:Malrd1	UTSW	2	15526653	missense	probably benign	0.00
R6034:Malrd1	UTSW	2	15845326	missense	possibly damaging	0.78
R6034:Malrd1	UTSW	2	15845326	missense	possibly damaging	0.78
R6195:Malrd1	UTSW	2	15695326	missense	probably damaging	1.00
R6318:Malrd1	UTSW	2	16042267	missense	unknown
R6438:Malrd1	UTSW	2	15614206	missense
R6457:Malrd1	UTSW	2	15526597	start gained	probably benign
R6457:Malrd1	UTSW	2	15667929	missense	probably benign	0.41
R6499:Malrd1	UTSW	2	15931689	missense	probably benign	0.03
R6575:Malrd1	UTSW	2	15842628	missense	probably benign	0.00
R6792:Malrd1	UTSW	2	16150756	missense	unknown
R6796:Malrd1	UTSW	2	15869784	missense	unknown
R6930:Malrd1	UTSW	2	15797667	missense	unknown
R6959:Malrd1	UTSW	2	16218009	missense	probably damaging	0.97
R6993:Malrd1	UTSW	2	16150791	missense	unknown
R7102:Malrd1	UTSW	2	16142303	missense	unknown
R7112:Malrd1	UTSW	2	15925176	missense	unknown
R7248:Malrd1	UTSW	2	16101911	missense	unknown
R7249:Malrd1	UTSW	2	15623340	missense	probably damaging	0.97
R7334:Malrd1	UTSW	2	16006718	missense	probably damaging	0.99
R7394:Malrd1	UTSW	2	15695199	missense	unknown
R7399:Malrd1	UTSW	2	15610090	missense
R7476:Malrd1	UTSW	2	16142304	missense	unknown
R7582:Malrd1	UTSW	2	15695270	missense	unknown
R7604:Malrd1	UTSW	2	15925192	missense	unknown
R7662:Malrd1	UTSW	2	15871454	missense	unknown
R7681:Malrd1	UTSW	2	16218102	missense	unknown
R7740:Malrd1	UTSW	2	15614215	missense	not run
R7747:Malrd1	UTSW	2	16074835	missense	unknown
R7754:Malrd1	UTSW	2	15797799	splice site	probably null
R7950:Malrd1	UTSW	2	16128068	missense	unknown
R8194:Malrd1	UTSW	2	15925120	missense	unknown
R8260:Malrd1	UTSW	2	15614206	missense
R8314:Malrd1	UTSW	2	15752832	missense	unknown
R8342:Malrd1	UTSW	2	15633224	missense	unknown
R8386:Malrd1	UTSW	2	15696844	missense	unknown
R8492:Malrd1	UTSW	2	15610123	missense
R8728:Malrd1	UTSW	2	15696942	nonsense	probably null
R8756:Malrd1	UTSW	2	15752895	critical splice donor site	probably null
R8869:Malrd1	UTSW	2	15565557	critical splice donor site	probably null
R8888:Malrd1	UTSW	2	15845227	missense	unknown
R8895:Malrd1	UTSW	2	15845227	missense	unknown
R8902:Malrd1	UTSW	2	16255334	nonsense	probably null
R8954:Malrd1	UTSW	2	15551367	missense
R8960:Malrd1	UTSW	2	15565430	nonsense	probably null
R9005:Malrd1	UTSW	2	15845329	missense	unknown
R9135:Malrd1	UTSW	2	15797705	missense	unknown
R9267:Malrd1	UTSW	2	16255266	missense	unknown
R9330:Malrd1	UTSW	2	16255278	missense	unknown
R9359:Malrd1	UTSW	2	15614177	missense
R9383:Malrd1	UTSW	2	15695201	missense	unknown
R9389:Malrd1	UTSW	2	15703156	missense	unknown
R9403:Malrd1	UTSW	2	15614177	missense
R9454:Malrd1	UTSW	2	15752849	missense	unknown
R9454:Malrd1	UTSW	2	15797726	nonsense	probably null
R9520:Malrd1	UTSW	2	16074820	missense	unknown
R9544:Malrd1	UTSW	2	15635998	missense	unknown
R9609:Malrd1	UTSW	2	15695270	missense	unknown
R9667:Malrd1	UTSW	2	15565215	critical splice acceptor site	probably null
R9721:Malrd1	UTSW	2	15696827	missense	unknown
R9787:Malrd1	UTSW	2	15620590	missense	unknown
R9800:Malrd1	UTSW	2	15842594	missense	unknown
Z1176:Malrd1	UTSW	2	16217845	missense	unknown
Z1191:Malrd1	UTSW	2	16042226	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AGGAGTGAACTGACATGTGTT -3'
(R):5'- TGGTACACATGAAGACAAGCA -3'

Sequencing Primer
(F):5'- AGCTTATCAGTAATTGGTGCAATC -3'
(R):5'- GTACACATGAAGACAAGCAGACCC -3'

Posted On

2017-02-15