Incidental Mutation 'R0558:Olfr1350'
ID45723
Institutional Source Beutler Lab
Gene Symbol Olfr1350
Ensembl Gene ENSMUSG00000056696
Gene Nameolfactory receptor 1350
SynonymsGA_x6K02T2QGBW-3300391-3301317, MOR222-3
MMRRC Submission 038750-MU
Accession Numbers

Genbank: NM_146389.1

Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R0558 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location6564841-6571401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6570653 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 221 (Y221H)
Ref Sequence ENSEMBL: ENSMUSP00000151318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070985] [ENSMUST00000207221] [ENSMUST00000219278]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070985
AA Change: Y221H

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000069927
Gene: ENSMUSG00000056696
AA Change: Y221H

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.6e-50 PFAM
Pfam:7tm_1 39 288 8.2e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000207221
AA Change: Y221H

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219278
AA Change: Y221H

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik T C 17: 25,947,549 N338S probably benign Het
Abcc2 G A 19: 43,800,724 G273R probably benign Het
Adamts10 T C 17: 33,550,609 V935A probably benign Het
Anapc15-ps T C 10: 95,673,121 D90G probably damaging Het
Atic T A 1: 71,563,788 V107E probably benign Het
Atp4b T C 8: 13,393,523 T52A possibly damaging Het
Cacna1h C T 17: 25,381,550 A1606T probably damaging Het
Cacng6 T A 7: 3,434,808 Y217* probably null Het
Cc2d2a T G 5: 43,724,387 probably benign Het
Cd226 T A 18: 89,207,214 H78Q probably benign Het
Cers3 A G 7: 66,783,418 D161G probably damaging Het
Ces1f T C 8: 93,275,389 H37R probably benign Het
Chek1 T A 9: 36,712,115 N421I possibly damaging Het
Cma2 T C 14: 55,972,792 Y45H probably damaging Het
Cmas C A 6: 142,775,244 Y401* probably null Het
Cyp2j8 A T 4: 96,444,634 S492T probably benign Het
Dnah12 T C 14: 26,709,310 S358P probably benign Het
Dnajc13 T C 9: 104,201,952 probably null Het
Ep400 A C 5: 110,685,067 probably benign Het
Fam209 T A 2: 172,472,838 N82K probably benign Het
Fam92a T C 4: 12,164,095 D248G probably damaging Het
G3bp2 A T 5: 92,073,197 Y20N probably damaging Het
Gli2 T C 1: 118,837,649 D924G probably benign Het
Gm10787 T C 10: 77,022,016 noncoding transcript Het
Gm11568 A G 11: 99,858,046 R26G unknown Het
Gm4788 A G 1: 139,739,492 V376A probably damaging Het
Hivep3 T G 4: 120,096,566 L693R probably damaging Het
Hook1 A G 4: 95,993,212 probably benign Het
Ibtk A C 9: 85,737,538 D116E probably damaging Het
Insrr C T 3: 87,810,981 T927I possibly damaging Het
Irx1 T G 13: 71,959,628 S312R probably benign Het
Itga11 T C 9: 62,752,288 Y441H probably benign Het
Itsn1 A G 16: 91,899,623 D38G possibly damaging Het
Kat6b G T 14: 21,669,421 E1280D probably benign Het
Kcnk10 T A 12: 98,436,301 Y293F possibly damaging Het
Krt74 T A 15: 101,760,963 noncoding transcript Het
Lars T G 18: 42,214,837 I974L probably benign Het
Limch1 A G 5: 66,969,155 D42G probably damaging Het
Mau2 G C 8: 70,042,432 T85R probably damaging Het
Mkrn3 A G 7: 62,418,864 I393T probably benign Het
Mpl A C 4: 118,444,020 S541R probably damaging Het
Nfrkb T C 9: 31,410,268 S754P possibly damaging Het
Olfr1170 A G 2: 88,224,474 V186A possibly damaging Het
Olfr1233 A G 2: 89,340,236 L22P probably benign Het
Olfr1537 T A 9: 39,238,200 T75S probably damaging Het
P2rx7 A T 5: 122,673,798 I391F possibly damaging Het
Pbrm1 T A 14: 31,085,059 probably null Het
Pcdh8 T C 14: 79,770,076 D349G probably damaging Het
Pias1 A G 9: 62,882,009 S639P possibly damaging Het
Pkhd1l1 A T 15: 44,484,424 I232F probably damaging Het
Plxnc1 C T 10: 94,837,935 R995Q probably damaging Het
Pnliprp2 T A 19: 58,774,087 S375T probably benign Het
Prkar1b C T 5: 139,020,092 V313M probably benign Het
Ptpn13 T C 5: 103,529,717 S734P probably damaging Het
Rdh1 T C 10: 127,759,941 W2R possibly damaging Het
Rsph10b A T 5: 143,949,338 I285L probably benign Het
Rubcnl T C 14: 75,047,547 F502S probably damaging Het
Ryr2 T A 13: 11,638,443 I3693F probably damaging Het
Ryr2 T C 13: 11,799,861 Y675C probably damaging Het
Scaper T C 9: 55,685,923 T477A probably benign Het
Scn2a G T 2: 65,711,925 V791L probably benign Het
Sdk1 A T 5: 142,132,065 T1573S probably damaging Het
Sema3c A T 5: 17,714,415 H483L probably benign Het
Sema6c T C 3: 95,168,691 S219P probably damaging Het
Slc10a5 T G 3: 10,335,117 E161A probably damaging Het
Slc22a23 C T 13: 34,344,383 G139S possibly damaging Het
Slc34a3 C T 2: 25,233,065 probably benign Het
Slc38a9 A T 13: 112,729,196 probably null Het
Taok1 A C 11: 77,559,844 S367R possibly damaging Het
Tlr6 G A 5: 64,954,860 Q235* probably null Het
Top2a A G 11: 98,996,839 V1281A probably benign Het
Tpgs1 T C 10: 79,675,782 Y253H probably damaging Het
Tubgcp3 T C 8: 12,653,462 T288A probably benign Het
Ubr4 A G 4: 139,426,902 E2140G probably benign Het
Uso1 A G 5: 92,174,019 Q257R probably benign Het
Zfp106 A G 2: 120,532,196 V48A probably damaging Het
Zfp174 T A 16: 3,848,254 S128T possibly damaging Het
Zscan26 T A 13: 21,445,055 D426V probably benign Het
Other mutations in Olfr1350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Olfr1350 APN 7 6570668 missense possibly damaging 0.88
IGL01387:Olfr1350 APN 7 6570855 missense probably damaging 1.00
IGL01457:Olfr1350 APN 7 6570212 missense probably benign 0.12
IGL01568:Olfr1350 APN 7 6570570 missense possibly damaging 0.91
I2288:Olfr1350 UTSW 7 6570819 missense probably damaging 1.00
I2289:Olfr1350 UTSW 7 6570819 missense probably damaging 1.00
R0454:Olfr1350 UTSW 7 6570360 missense probably damaging 1.00
R1103:Olfr1350 UTSW 7 6570112 missense probably damaging 1.00
R1352:Olfr1350 UTSW 7 6570783 missense probably benign 0.11
R1503:Olfr1350 UTSW 7 6570471 missense probably damaging 1.00
R1630:Olfr1350 UTSW 7 6570674 missense probably damaging 1.00
R1981:Olfr1350 UTSW 7 6570558 missense probably benign 0.01
R2228:Olfr1350 UTSW 7 6570803 missense probably benign
R2258:Olfr1350 UTSW 7 6570023 missense probably damaging 0.98
R2259:Olfr1350 UTSW 7 6570023 missense probably damaging 0.98
R2260:Olfr1350 UTSW 7 6570023 missense probably damaging 0.98
R4075:Olfr1350 UTSW 7 6570143 missense probably benign 0.00
R4750:Olfr1350 UTSW 7 6570851 missense probably benign 0.34
R4917:Olfr1350 UTSW 7 6570644 missense possibly damaging 0.88
R4918:Olfr1350 UTSW 7 6570644 missense possibly damaging 0.88
R5571:Olfr1350 UTSW 7 6570825 missense possibly damaging 0.95
R5915:Olfr1350 UTSW 7 6570173 missense probably benign 0.31
R6969:Olfr1350 UTSW 7 6570321 missense probably damaging 1.00
R7061:Olfr1350 UTSW 7 6570783 missense probably damaging 1.00
R7286:Olfr1350 UTSW 7 6570716 missense probably damaging 1.00
R7510:Olfr1350 UTSW 7 6569961 start gained probably benign
V1662:Olfr1350 UTSW 7 6570819 missense probably damaging 1.00
Z1176:Olfr1350 UTSW 7 6570048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGAGTTCTCAGACCTGTGTGTCC -3'
(R):5'- CGCAGAGCTGCTTTCATGTCCTTG -3'

Sequencing Primer
(F):5'- TGGGTCAGTGGACTCCTC -3'
(R):5'- TTCAGAGTTGGCATGAGGATAG -3'
Posted On2013-06-11