Mutagenetix > Incidental Mutation

Incidental Mutation 'R5892:Abcb11'

457230

Institutional Source

Beutler Lab

Gene Symbol

Abcb11

Ensembl Gene

ENSMUSG00000027048

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 11

Synonyms

PFIC2, Bsep, PGY4, Lith1, ABC16, sister of P-glycoprotein

MMRRC Submission

044093-MU

Accession Numbers

Genbank: NM_021022; MGI: 1351619

Is this an essential gene?

Possibly essential (E-score: 0.643) question?

Stock #

R5892 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

69238282-69342616 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 69261500 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 893 (A893T)

Ref Sequence

ENSEMBL: ENSMUSP00000099771 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]

AlphaFold

Q9QY30

Predicted Effect

probably damaging
Transcript: ENSMUST00000102709
AA Change: A893T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048
AA Change: A893T

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	373	1.3e-65	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1031	2.7e-55	PFAM
AAA	1105	1299	1.9e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102710
AA Change: A893T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048
AA Change: A893T

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	371	1.7e-72	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1029	3.2e-59	PFAM
AAA	1105	1299	1.9e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126240

Predicted Effect

probably damaging
Transcript: ENSMUST00000180142
AA Change: A893T

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048
AA Change: A893T

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	371	1.4e-72	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1029	2.5e-59	PFAM
AAA	1105	1299	1.9e-17	SMART

Meta Mutation Damage Score

0.4534

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.6%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930524J08Rik	G	T	5: 99,979,265		probably benign	Het
Adtrp	A	T	13: 41,828,206	N30K	probably benign	Het
Alms1	T	A	6: 85,620,903	S904T	probably damaging	Het
Cep170	T	A	1: 176,755,387		probably null	Het
Cntnap3	A	G	13: 64,799,180	V145A	probably damaging	Het
Dclre1a	T	C	19: 56,547,140	E4G	probably benign	Het
Depdc1a	G	C	3: 159,526,669	A686P	probably damaging	Het
Dnah7b	T	C	1: 46,337,593		probably null	Het
Enox1	A	G	14: 77,486,017		probably benign	Het
Fam107b	A	G	2: 3,778,564	E268G	probably damaging	Het
Fer1l6	A	G	15: 58,564,068	S437G	probably benign	Het
Flnb	C	A	14: 7,907,183	T1252K	probably damaging	Het
Fubp1	A	G	3: 152,218,314		probably benign	Het
Gm20402	G	A	3: 52,268,949	A50T	probably benign	Het
Gpr137b	T	C	13: 13,359,406	Y355C		Het
Gzmk	C	T	13: 113,173,922		probably null	Het
Ino80	A	T	2: 119,439,547		probably benign	Het
Ints8	T	C	4: 11,223,813	T677A	probably damaging	Het
Kat6a	A	G	8: 22,938,289	E1220G	probably damaging	Het
Lrfn5	A	G	12: 61,843,418	T498A	probably damaging	Het
Lrp2	T	A	2: 69,442,776	T4043S	probably benign	Het
Malrd1	A	G	2: 15,614,267	N314S	probably benign	Het
Mfsd1	A	G	3: 67,589,829		probably null	Het
Muc1	C	T	3: 89,230,993	P381S	probably benign	Het
Myh2	A	T	11: 67,185,176	K730*	probably null	Het
Nat3	T	A	8: 67,547,938	N156K	probably benign	Het
Nelfe	T	C	17: 34,854,669		probably benign	Het
Nlrp1a	A	T	11: 71,099,645	L927Q	probably damaging	Het
P4ha2	A	G	11: 54,120,188	Y343C	probably damaging	Het
Pclo	A	T	5: 14,521,171	Q190L	probably damaging	Het
Pde8a	A	G	7: 81,295,691	N183S	probably damaging	Het
Plekha2	C	T	8: 25,052,365	V278I	probably benign	Het
Plekha6	G	C	1: 133,272,307	R208P	possibly damaging	Het
Plxnb1	T	C	9: 109,111,707	L1550P	probably damaging	Het
Ppox	C	T	1: 171,277,461	V385I	probably damaging	Het
Prdm16	T	C	4: 154,323,259	D1170G	possibly damaging	Het
Prmt5	A	T	14: 54,509,911	S470T	probably damaging	Het
Robo2	T	A	16: 73,895,780		probably benign	Het
Siglecg	G	A	7: 43,412,204		probably benign	Het
Slc30a5	T	C	13: 100,813,302	N367S	probably damaging	Het
Tex29	C	T	8: 11,854,288		probably benign	Het
Tmem117	T	A	15: 94,638,139	V18E	probably damaging	Het
Tmtc2	C	T	10: 105,413,505	M122I	probably benign	Het
Tpr	T	A	1: 150,407,400	N287K	probably benign	Het
Unc93b1	A	T	19: 3,943,632	D358V	probably damaging	Het
Vrk2	A	T	11: 26,534,372		probably benign	Het
Wdr24	A	T	17: 25,827,986	Q671L	probably benign	Het
Zfp110	C	T	7: 12,848,478	T351I	probably benign	Het
Zfp963	T	C	8: 69,743,377	D142G	probably benign	Het

Other mutations in Abcb11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00544:Abcb11	APN	2	69284681	missense	possibly damaging	0.90
IGL01407:Abcb11	APN	2	69245944	missense	probably damaging	1.00
IGL01583:Abcb11	APN	2	69296409	missense	possibly damaging	0.81
IGL01813:Abcb11	APN	2	69287592	splice site	probably benign
IGL01885:Abcb11	APN	2	69287627	missense	probably damaging	1.00
IGL01937:Abcb11	APN	2	69287612	missense	probably damaging	1.00
IGL02058:Abcb11	APN	2	69243498	missense	probably damaging	0.98
IGL02117:Abcb11	APN	2	69323825	splice site	probably benign
IGL02119:Abcb11	APN	2	69328000	critical splice acceptor site	probably null
IGL02120:Abcb11	APN	2	69257310	missense	probably damaging	1.00
IGL02158:Abcb11	APN	2	69299925	missense	probably damaging	0.96
IGL02212:Abcb11	APN	2	69248889	missense	probably damaging	0.97
IGL02306:Abcb11	APN	2	69265457	nonsense	probably null
IGL02505:Abcb11	APN	2	69245761	missense	probably damaging	1.00
IGL02538:Abcb11	APN	2	69306605	missense	possibly damaging	0.67
IGL02793:Abcb11	APN	2	69291949	missense	possibly damaging	0.90
IGL02863:Abcb11	APN	2	69284682	missense	probably damaging	0.99
IGL02875:Abcb11	APN	2	69291949	missense	possibly damaging	0.90
IGL03164:Abcb11	APN	2	69291999	nonsense	probably null
IGL03181:Abcb11	APN	2	69328008	intron	probably benign
3-1:Abcb11	UTSW	2	69327993	missense	probably benign	0.00
FR4737:Abcb11	UTSW	2	69243518	missense	probably damaging	0.97
R0031:Abcb11	UTSW	2	69285308	missense	probably damaging	1.00
R0398:Abcb11	UTSW	2	69286666	missense	probably null	0.82
R0413:Abcb11	UTSW	2	69328011	intron	probably benign
R0437:Abcb11	UTSW	2	69257295	missense	probably damaging	1.00
R0496:Abcb11	UTSW	2	69277884	splice site	probably benign
R0646:Abcb11	UTSW	2	69285283	missense	probably damaging	1.00
R0669:Abcb11	UTSW	2	69329318	missense	probably benign	0.15
R0856:Abcb11	UTSW	2	69323918	missense	probably benign
R1061:Abcb11	UTSW	2	69277809	missense	probably benign	0.00
R1460:Abcb11	UTSW	2	69257374	splice site	probably benign
R1714:Abcb11	UTSW	2	69306581	missense	probably damaging	0.99
R1739:Abcb11	UTSW	2	69261566	missense	probably damaging	1.00
R1856:Abcb11	UTSW	2	69245923	missense	probably damaging	1.00
R1994:Abcb11	UTSW	2	69282670	splice site	probably null
R2086:Abcb11	UTSW	2	69259476	splice site	probably benign
R2133:Abcb11	UTSW	2	69323883	missense	possibly damaging	0.65
R2516:Abcb11	UTSW	2	69329329	missense	possibly damaging	0.88
R2930:Abcb11	UTSW	2	69257358	missense	probably damaging	0.96
R3771:Abcb11	UTSW	2	69329376	splice site	probably benign
R3772:Abcb11	UTSW	2	69329376	splice site	probably benign
R3979:Abcb11	UTSW	2	69323976	missense	probably benign	0.11
R4227:Abcb11	UTSW	2	69284776	missense	probably damaging	1.00
R4255:Abcb11	UTSW	2	69306605	missense	probably benign	0.03
R4614:Abcb11	UTSW	2	69284681	missense	possibly damaging	0.90
R4647:Abcb11	UTSW	2	69285271	missense	probably damaging	1.00
R4719:Abcb11	UTSW	2	69259627	missense	probably damaging	1.00
R4734:Abcb11	UTSW	2	69323962	missense	possibly damaging	0.73
R4765:Abcb11	UTSW	2	69245867	missense	probably damaging	1.00
R4861:Abcb11	UTSW	2	69245905	missense	probably damaging	1.00
R4861:Abcb11	UTSW	2	69245905	missense	probably damaging	1.00
R4870:Abcb11	UTSW	2	69239196	missense	probably damaging	0.99
R4988:Abcb11	UTSW	2	69323892	missense	probably benign	0.12
R5028:Abcb11	UTSW	2	69274012	missense	probably damaging	1.00
R5048:Abcb11	UTSW	2	69308506	missense	probably benign	0.06
R5177:Abcb11	UTSW	2	69285295	missense	probably damaging	1.00
R5301:Abcb11	UTSW	2	69286847	missense	probably damaging	0.98
R5789:Abcb11	UTSW	2	69245764	missense	probably damaging	1.00
R6003:Abcb11	UTSW	2	69243467	missense	probably benign	0.43
R6252:Abcb11	UTSW	2	69291961	missense	probably benign	0.10
R6389:Abcb11	UTSW	2	69323894	missense	probably damaging	1.00
R6512:Abcb11	UTSW	2	69282652	missense	probably benign
R6590:Abcb11	UTSW	2	69284718	missense	probably damaging	1.00
R6690:Abcb11	UTSW	2	69284718	missense	probably damaging	1.00
R6732:Abcb11	UTSW	2	69286846	missense	probably damaging	1.00
R6870:Abcb11	UTSW	2	69285298	missense	possibly damaging	0.91
R7028:Abcb11	UTSW	2	69265675	missense	probably benign
R7223:Abcb11	UTSW	2	69274143	missense	probably benign
R7323:Abcb11	UTSW	2	69287635	missense	probably damaging	1.00
R7337:Abcb11	UTSW	2	69245769	missense	probably damaging	1.00
R7339:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7340:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7341:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7343:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7366:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7393:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7394:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7405:Abcb11	UTSW	2	69287619	missense	probably damaging	1.00
R7411:Abcb11	UTSW	2	69303936	critical splice donor site	probably null
R7488:Abcb11	UTSW	2	69277802	missense	probably benign
R7544:Abcb11	UTSW	2	69265486	missense	probably benign	0.05
R7660:Abcb11	UTSW	2	69287594	splice site	probably null
R7754:Abcb11	UTSW	2	69286818	missense	probably damaging	1.00
R7771:Abcb11	UTSW	2	69239191	missense	probably damaging	0.99
R7794:Abcb11	UTSW	2	69286678	missense	possibly damaging	0.62
R7834:Abcb11	UTSW	2	69284724	missense	probably damaging	1.00
R7897:Abcb11	UTSW	2	69323872	frame shift	probably null
R7897:Abcb11	UTSW	2	69323873	small deletion	probably benign
R7937:Abcb11	UTSW	2	69323873	small deletion	probably benign
R8004:Abcb11	UTSW	2	69257210	missense	possibly damaging	0.68
R8089:Abcb11	UTSW	2	69274039	missense	probably benign	0.09
R8279:Abcb11	UTSW	2	69239205	missense	probably benign	0.05
R8426:Abcb11	UTSW	2	69325262	missense	probably benign
R8441:Abcb11	UTSW	2	69257230	missense	possibly damaging	0.93
R8460:Abcb11	UTSW	2	69324037	missense	possibly damaging	0.70
R8462:Abcb11	UTSW	2	69274155	missense	probably benign
R8532:Abcb11	UTSW	2	69259691	missense	possibly damaging	0.69
R8534:Abcb11	UTSW	2	69323846	missense	possibly damaging	0.89
R8711:Abcb11	UTSW	2	69265512	missense	probably damaging	1.00
R8746:Abcb11	UTSW	2	69257410	intron	probably benign
R8964:Abcb11	UTSW	2	69286717	missense	possibly damaging	0.52
R8990:Abcb11	UTSW	2	69274150	missense
R9081:Abcb11	UTSW	2	69292044	missense	possibly damaging	0.59
R9093:Abcb11	UTSW	2	69239169	missense	probably damaging	0.97
R9228:Abcb11	UTSW	2	69308465	nonsense	probably null
R9294:Abcb11	UTSW	2	69265496	missense	possibly damaging	0.89
X0058:Abcb11	UTSW	2	69289443	missense	probably benign	0.12
X0062:Abcb11	UTSW	2	69245906	missense	probably damaging	1.00
X0065:Abcb11	UTSW	2	69299866	missense	probably damaging	0.99
Z1176:Abcb11	UTSW	2	69291981	missense	probably damaging	1.00
Z1177:Abcb11	UTSW	2	69306529	missense	probably damaging	1.00
Z1177:Abcb11	UTSW	2	69329269	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CCACCTAGTCATTAGAAGGGAAATGAG -3'
(R):5'- CTGAGTTATGGACTTAGGAATGGC -3'

Sequencing Primer
(F):5'- GGTCTATAAGATTACCTGGCCAGC -3'
(R):5'- TATGGACTTAGGAATGGCTAAAAAGC -3'

Posted On

2017-02-15