Incidental Mutation 'R5892:Abcb11'
ID 457230
Institutional Source Beutler Lab
Gene Symbol Abcb11
Ensembl Gene ENSMUSG00000027048
Gene Name ATP-binding cassette, sub-family B member 11
Synonyms sister of P-glycoprotein, ABC16, PFIC2, Bsep, PGY4, Lith1
MMRRC Submission 044093-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.732) question?
Stock # R5892 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 69068626-69172960 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 69091844 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 893 (A893T)
Ref Sequence ENSEMBL: ENSMUSP00000099771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]
AlphaFold Q9QY30
Predicted Effect probably damaging
Transcript: ENSMUST00000102709
AA Change: A893T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048
AA Change: A893T

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 373 1.3e-65 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1031 2.7e-55 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102710
AA Change: A893T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048
AA Change: A893T

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.7e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 3.2e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126240
Predicted Effect probably damaging
Transcript: ENSMUST00000180142
AA Change: A893T

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048
AA Change: A893T

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.4e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 2.5e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Meta Mutation Damage Score 0.4534 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik G T 5: 100,127,124 (GRCm39) probably benign Het
Adtrp A T 13: 41,981,682 (GRCm39) N30K probably benign Het
Alms1 T A 6: 85,597,885 (GRCm39) S904T probably damaging Het
Cep170 T A 1: 176,582,953 (GRCm39) probably null Het
Cntnap3 A G 13: 64,946,994 (GRCm39) V145A probably damaging Het
Dclre1a T C 19: 56,535,572 (GRCm39) E4G probably benign Het
Depdc1a G C 3: 159,232,306 (GRCm39) A686P probably damaging Het
Dnah7b T C 1: 46,376,753 (GRCm39) probably null Het
Enox1 A G 14: 77,723,457 (GRCm39) probably benign Het
Fam107b A G 2: 3,779,601 (GRCm39) E268G probably damaging Het
Fer1l6 A G 15: 58,435,917 (GRCm39) S437G probably benign Het
Flnb C A 14: 7,907,183 (GRCm38) T1252K probably damaging Het
Fubp1 A G 3: 151,923,951 (GRCm39) probably benign Het
Gm20402 G A 3: 52,176,370 (GRCm39) A50T probably benign Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Gzmk C T 13: 113,310,456 (GRCm39) probably null Het
Ino80 A T 2: 119,270,028 (GRCm39) probably benign Het
Ints8 T C 4: 11,223,813 (GRCm39) T677A probably damaging Het
Kat6a A G 8: 23,428,305 (GRCm39) E1220G probably damaging Het
Lrfn5 A G 12: 61,890,204 (GRCm39) T498A probably damaging Het
Lrp2 T A 2: 69,273,120 (GRCm39) T4043S probably benign Het
Malrd1 A G 2: 15,619,078 (GRCm39) N314S probably benign Het
Mfsd1 A G 3: 67,497,162 (GRCm39) probably null Het
Muc1 C T 3: 89,138,300 (GRCm39) P381S probably benign Het
Myh2 A T 11: 67,076,002 (GRCm39) K730* probably null Het
Nat3 T A 8: 68,000,590 (GRCm39) N156K probably benign Het
Nelfe T C 17: 35,073,645 (GRCm39) probably benign Het
Nlrp1a A T 11: 70,990,471 (GRCm39) L927Q probably damaging Het
P4ha2 A G 11: 54,011,014 (GRCm39) Y343C probably damaging Het
Pclo A T 5: 14,571,185 (GRCm39) Q190L probably damaging Het
Pde8a A G 7: 80,945,439 (GRCm39) N183S probably damaging Het
Plekha2 C T 8: 25,542,381 (GRCm39) V278I probably benign Het
Plekha6 G C 1: 133,200,045 (GRCm39) R208P possibly damaging Het
Plxnb1 T C 9: 108,940,775 (GRCm39) L1550P probably damaging Het
Ppox C T 1: 171,105,034 (GRCm39) V385I probably damaging Het
Prdm16 T C 4: 154,407,716 (GRCm39) D1170G possibly damaging Het
Prmt5 A T 14: 54,747,368 (GRCm39) S470T probably damaging Het
Robo2 T A 16: 73,692,668 (GRCm39) probably benign Het
Siglecg G A 7: 43,061,628 (GRCm39) probably benign Het
Slc30a5 T C 13: 100,949,810 (GRCm39) N367S probably damaging Het
Tex29 C T 8: 11,904,288 (GRCm39) probably benign Het
Tmem117 T A 15: 94,536,020 (GRCm39) V18E probably damaging Het
Tmtc2 C T 10: 105,249,366 (GRCm39) M122I probably benign Het
Tpr T A 1: 150,283,151 (GRCm39) N287K probably benign Het
Unc93b1 A T 19: 3,993,632 (GRCm39) D358V probably damaging Het
Vrk2 A T 11: 26,484,372 (GRCm39) probably benign Het
Wdr24 A T 17: 26,046,960 (GRCm39) Q671L probably benign Het
Zfp110 C T 7: 12,582,405 (GRCm39) T351I probably benign Het
Zfp963 T C 8: 70,196,027 (GRCm39) D142G probably benign Het
Other mutations in Abcb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Abcb11 APN 2 69,115,025 (GRCm39) missense possibly damaging 0.90
IGL01407:Abcb11 APN 2 69,076,288 (GRCm39) missense probably damaging 1.00
IGL01583:Abcb11 APN 2 69,126,753 (GRCm39) missense possibly damaging 0.81
IGL01813:Abcb11 APN 2 69,117,936 (GRCm39) splice site probably benign
IGL01885:Abcb11 APN 2 69,117,971 (GRCm39) missense probably damaging 1.00
IGL01937:Abcb11 APN 2 69,117,956 (GRCm39) missense probably damaging 1.00
IGL02058:Abcb11 APN 2 69,073,842 (GRCm39) missense probably damaging 0.98
IGL02117:Abcb11 APN 2 69,154,169 (GRCm39) splice site probably benign
IGL02119:Abcb11 APN 2 69,158,344 (GRCm39) critical splice acceptor site probably null
IGL02120:Abcb11 APN 2 69,087,654 (GRCm39) missense probably damaging 1.00
IGL02158:Abcb11 APN 2 69,130,269 (GRCm39) missense probably damaging 0.96
IGL02212:Abcb11 APN 2 69,079,233 (GRCm39) missense probably damaging 0.97
IGL02306:Abcb11 APN 2 69,095,801 (GRCm39) nonsense probably null
IGL02505:Abcb11 APN 2 69,076,105 (GRCm39) missense probably damaging 1.00
IGL02538:Abcb11 APN 2 69,136,949 (GRCm39) missense possibly damaging 0.67
IGL02793:Abcb11 APN 2 69,122,293 (GRCm39) missense possibly damaging 0.90
IGL02863:Abcb11 APN 2 69,115,026 (GRCm39) missense probably damaging 0.99
IGL02875:Abcb11 APN 2 69,122,293 (GRCm39) missense possibly damaging 0.90
IGL03164:Abcb11 APN 2 69,122,343 (GRCm39) nonsense probably null
IGL03181:Abcb11 APN 2 69,158,352 (GRCm39) intron probably benign
3-1:Abcb11 UTSW 2 69,158,337 (GRCm39) missense probably benign 0.00
FR4737:Abcb11 UTSW 2 69,073,862 (GRCm39) missense probably damaging 0.97
R0031:Abcb11 UTSW 2 69,115,652 (GRCm39) missense probably damaging 1.00
R0398:Abcb11 UTSW 2 69,117,010 (GRCm39) missense probably null 0.82
R0413:Abcb11 UTSW 2 69,158,355 (GRCm39) intron probably benign
R0437:Abcb11 UTSW 2 69,087,639 (GRCm39) missense probably damaging 1.00
R0496:Abcb11 UTSW 2 69,108,228 (GRCm39) splice site probably benign
R0646:Abcb11 UTSW 2 69,115,627 (GRCm39) missense probably damaging 1.00
R0669:Abcb11 UTSW 2 69,159,662 (GRCm39) missense probably benign 0.15
R0856:Abcb11 UTSW 2 69,154,262 (GRCm39) missense probably benign
R1061:Abcb11 UTSW 2 69,108,153 (GRCm39) missense probably benign 0.00
R1460:Abcb11 UTSW 2 69,087,718 (GRCm39) splice site probably benign
R1714:Abcb11 UTSW 2 69,136,925 (GRCm39) missense probably damaging 0.99
R1739:Abcb11 UTSW 2 69,091,910 (GRCm39) missense probably damaging 1.00
R1856:Abcb11 UTSW 2 69,076,267 (GRCm39) missense probably damaging 1.00
R1994:Abcb11 UTSW 2 69,113,014 (GRCm39) splice site probably null
R2086:Abcb11 UTSW 2 69,089,820 (GRCm39) splice site probably benign
R2133:Abcb11 UTSW 2 69,154,227 (GRCm39) missense possibly damaging 0.65
R2516:Abcb11 UTSW 2 69,159,673 (GRCm39) missense possibly damaging 0.88
R2930:Abcb11 UTSW 2 69,087,702 (GRCm39) missense probably damaging 0.96
R3771:Abcb11 UTSW 2 69,159,720 (GRCm39) splice site probably benign
R3772:Abcb11 UTSW 2 69,159,720 (GRCm39) splice site probably benign
R3979:Abcb11 UTSW 2 69,154,320 (GRCm39) missense probably benign 0.11
R4227:Abcb11 UTSW 2 69,115,120 (GRCm39) missense probably damaging 1.00
R4255:Abcb11 UTSW 2 69,136,949 (GRCm39) missense probably benign 0.03
R4614:Abcb11 UTSW 2 69,115,025 (GRCm39) missense possibly damaging 0.90
R4647:Abcb11 UTSW 2 69,115,615 (GRCm39) missense probably damaging 1.00
R4719:Abcb11 UTSW 2 69,089,971 (GRCm39) missense probably damaging 1.00
R4734:Abcb11 UTSW 2 69,154,306 (GRCm39) missense possibly damaging 0.73
R4765:Abcb11 UTSW 2 69,076,211 (GRCm39) missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69,076,249 (GRCm39) missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69,076,249 (GRCm39) missense probably damaging 1.00
R4870:Abcb11 UTSW 2 69,069,540 (GRCm39) missense probably damaging 0.99
R4988:Abcb11 UTSW 2 69,154,236 (GRCm39) missense probably benign 0.12
R5028:Abcb11 UTSW 2 69,104,356 (GRCm39) missense probably damaging 1.00
R5048:Abcb11 UTSW 2 69,138,850 (GRCm39) missense probably benign 0.06
R5177:Abcb11 UTSW 2 69,115,639 (GRCm39) missense probably damaging 1.00
R5301:Abcb11 UTSW 2 69,117,191 (GRCm39) missense probably damaging 0.98
R5789:Abcb11 UTSW 2 69,076,108 (GRCm39) missense probably damaging 1.00
R6003:Abcb11 UTSW 2 69,073,811 (GRCm39) missense probably benign 0.43
R6252:Abcb11 UTSW 2 69,122,305 (GRCm39) missense probably benign 0.10
R6389:Abcb11 UTSW 2 69,154,238 (GRCm39) missense probably damaging 1.00
R6512:Abcb11 UTSW 2 69,112,996 (GRCm39) missense probably benign
R6590:Abcb11 UTSW 2 69,115,062 (GRCm39) missense probably damaging 1.00
R6690:Abcb11 UTSW 2 69,115,062 (GRCm39) missense probably damaging 1.00
R6732:Abcb11 UTSW 2 69,117,190 (GRCm39) missense probably damaging 1.00
R6870:Abcb11 UTSW 2 69,115,642 (GRCm39) missense possibly damaging 0.91
R7028:Abcb11 UTSW 2 69,096,019 (GRCm39) missense probably benign
R7223:Abcb11 UTSW 2 69,104,487 (GRCm39) missense probably benign
R7323:Abcb11 UTSW 2 69,117,979 (GRCm39) missense probably damaging 1.00
R7337:Abcb11 UTSW 2 69,076,113 (GRCm39) missense probably damaging 1.00
R7339:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7340:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7341:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7343:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7366:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7393:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7394:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7405:Abcb11 UTSW 2 69,117,963 (GRCm39) missense probably damaging 1.00
R7411:Abcb11 UTSW 2 69,134,280 (GRCm39) critical splice donor site probably null
R7488:Abcb11 UTSW 2 69,108,146 (GRCm39) missense probably benign
R7544:Abcb11 UTSW 2 69,095,830 (GRCm39) missense probably benign 0.05
R7660:Abcb11 UTSW 2 69,117,938 (GRCm39) splice site probably null
R7754:Abcb11 UTSW 2 69,117,162 (GRCm39) missense probably damaging 1.00
R7771:Abcb11 UTSW 2 69,069,535 (GRCm39) missense probably damaging 0.99
R7794:Abcb11 UTSW 2 69,117,022 (GRCm39) missense possibly damaging 0.62
R7834:Abcb11 UTSW 2 69,115,068 (GRCm39) missense probably damaging 1.00
R7897:Abcb11 UTSW 2 69,154,217 (GRCm39) small deletion probably benign
R7897:Abcb11 UTSW 2 69,154,216 (GRCm39) frame shift probably null
R7937:Abcb11 UTSW 2 69,154,217 (GRCm39) small deletion probably benign
R8004:Abcb11 UTSW 2 69,087,554 (GRCm39) missense possibly damaging 0.68
R8089:Abcb11 UTSW 2 69,104,383 (GRCm39) missense probably benign 0.09
R8279:Abcb11 UTSW 2 69,069,549 (GRCm39) missense probably benign 0.05
R8426:Abcb11 UTSW 2 69,155,606 (GRCm39) missense probably benign
R8441:Abcb11 UTSW 2 69,087,574 (GRCm39) missense possibly damaging 0.93
R8460:Abcb11 UTSW 2 69,154,381 (GRCm39) missense possibly damaging 0.70
R8462:Abcb11 UTSW 2 69,104,499 (GRCm39) missense probably benign
R8532:Abcb11 UTSW 2 69,090,035 (GRCm39) missense possibly damaging 0.69
R8534:Abcb11 UTSW 2 69,154,190 (GRCm39) missense possibly damaging 0.89
R8711:Abcb11 UTSW 2 69,095,856 (GRCm39) missense probably damaging 1.00
R8746:Abcb11 UTSW 2 69,087,754 (GRCm39) intron probably benign
R8964:Abcb11 UTSW 2 69,117,061 (GRCm39) missense possibly damaging 0.52
R8990:Abcb11 UTSW 2 69,104,494 (GRCm39) missense
R9081:Abcb11 UTSW 2 69,122,388 (GRCm39) missense possibly damaging 0.59
R9093:Abcb11 UTSW 2 69,069,513 (GRCm39) missense probably damaging 0.97
R9228:Abcb11 UTSW 2 69,138,809 (GRCm39) nonsense probably null
R9294:Abcb11 UTSW 2 69,095,840 (GRCm39) missense possibly damaging 0.89
X0058:Abcb11 UTSW 2 69,119,787 (GRCm39) missense probably benign 0.12
X0062:Abcb11 UTSW 2 69,076,250 (GRCm39) missense probably damaging 1.00
X0065:Abcb11 UTSW 2 69,130,210 (GRCm39) missense probably damaging 0.99
Z1176:Abcb11 UTSW 2 69,122,325 (GRCm39) missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69,159,613 (GRCm39) critical splice donor site probably null
Z1177:Abcb11 UTSW 2 69,136,873 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACCTAGTCATTAGAAGGGAAATGAG -3'
(R):5'- CTGAGTTATGGACTTAGGAATGGC -3'

Sequencing Primer
(F):5'- GGTCTATAAGATTACCTGGCCAGC -3'
(R):5'- TATGGACTTAGGAATGGCTAAAAAGC -3'
Posted On 2017-02-15