Mutagenetix > Incidental Mutation

Incidental Mutation 'R5892:Ino80'

457232

Institutional Source

Beutler Lab

Gene Symbol

Ino80

Ensembl Gene

ENSMUSG00000034154

Gene Name

INO80 complex subunit

Synonyms

INO80, 2310079N15Rik, 4632409L19Rik, Inoc1

MMRRC Submission

044093-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R5892 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119373042-119477687 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to T at 119439547 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000106431 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049920] [ENSMUST00000110808]

AlphaFold

Q6ZPV2

Predicted Effect

probably benign
Transcript: ENSMUST00000049920

SMART Domains

Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154

Domain	Start	End	E-Value	Type
coiled coil region	131	165	N/A	INTRINSIC
low complexity region	206	242	N/A	INTRINSIC
Pfam:DBINO	275	407	6.6e-50	PFAM
low complexity region	474	489	N/A	INTRINSIC
DEXDc	516	714	6.27e-37	SMART
low complexity region	907	923	N/A	INTRINSIC
HELICc	1134	1217	2.86e-22	SMART
low complexity region	1270	1324	N/A	INTRINSIC
low complexity region	1357	1368	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1438	1450	N/A	INTRINSIC
low complexity region	1457	1483	N/A	INTRINSIC
low complexity region	1510	1521	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110808

SMART Domains

Protein: ENSMUSP00000106431
Gene: ENSMUSG00000034154

Domain	Start	End	E-Value	Type
coiled coil region	131	165	N/A	INTRINSIC
low complexity region	206	242	N/A	INTRINSIC
Pfam:DBINO	272	412	8.8e-55	PFAM
low complexity region	474	489	N/A	INTRINSIC
DEXDc	516	714	6.27e-37	SMART
low complexity region	907	923	N/A	INTRINSIC
PDB:3MWY\|W	1098	1136	6e-7	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138707

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.6%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930524J08Rik	G	T	5: 99,979,265		probably benign	Het
Abcb11	C	T	2: 69,261,500	A893T	probably damaging	Het
Adtrp	A	T	13: 41,828,206	N30K	probably benign	Het
Alms1	T	A	6: 85,620,903	S904T	probably damaging	Het
Cep170	T	A	1: 176,755,387		probably null	Het
Cntnap3	A	G	13: 64,799,180	V145A	probably damaging	Het
Dclre1a	T	C	19: 56,547,140	E4G	probably benign	Het
Depdc1a	G	C	3: 159,526,669	A686P	probably damaging	Het
Dnah7b	T	C	1: 46,337,593		probably null	Het
Enox1	A	G	14: 77,486,017		probably benign	Het
Fam107b	A	G	2: 3,778,564	E268G	probably damaging	Het
Fer1l6	A	G	15: 58,564,068	S437G	probably benign	Het
Flnb	C	A	14: 7,907,183	T1252K	probably damaging	Het
Fubp1	A	G	3: 152,218,314		probably benign	Het
Gm20402	G	A	3: 52,268,949	A50T	probably benign	Het
Gpr137b	T	C	13: 13,359,406	Y355C		Het
Gzmk	C	T	13: 113,173,922		probably null	Het
Ints8	T	C	4: 11,223,813	T677A	probably damaging	Het
Kat6a	A	G	8: 22,938,289	E1220G	probably damaging	Het
Lrfn5	A	G	12: 61,843,418	T498A	probably damaging	Het
Lrp2	T	A	2: 69,442,776	T4043S	probably benign	Het
Malrd1	A	G	2: 15,614,267	N314S	probably benign	Het
Mfsd1	A	G	3: 67,589,829		probably null	Het
Muc1	C	T	3: 89,230,993	P381S	probably benign	Het
Myh2	A	T	11: 67,185,176	K730*	probably null	Het
Nat3	T	A	8: 67,547,938	N156K	probably benign	Het
Nelfe	T	C	17: 34,854,669		probably benign	Het
Nlrp1a	A	T	11: 71,099,645	L927Q	probably damaging	Het
P4ha2	A	G	11: 54,120,188	Y343C	probably damaging	Het
Pclo	A	T	5: 14,521,171	Q190L	probably damaging	Het
Pde8a	A	G	7: 81,295,691	N183S	probably damaging	Het
Plekha2	C	T	8: 25,052,365	V278I	probably benign	Het
Plekha6	G	C	1: 133,272,307	R208P	possibly damaging	Het
Plxnb1	T	C	9: 109,111,707	L1550P	probably damaging	Het
Ppox	C	T	1: 171,277,461	V385I	probably damaging	Het
Prdm16	T	C	4: 154,323,259	D1170G	possibly damaging	Het
Prmt5	A	T	14: 54,509,911	S470T	probably damaging	Het
Robo2	T	A	16: 73,895,780		probably benign	Het
Siglecg	G	A	7: 43,412,204		probably benign	Het
Slc30a5	T	C	13: 100,813,302	N367S	probably damaging	Het
Tex29	C	T	8: 11,854,288		probably benign	Het
Tmem117	T	A	15: 94,638,139	V18E	probably damaging	Het
Tmtc2	C	T	10: 105,413,505	M122I	probably benign	Het
Tpr	T	A	1: 150,407,400	N287K	probably benign	Het
Unc93b1	A	T	19: 3,943,632	D358V	probably damaging	Het
Vrk2	A	T	11: 26,534,372		probably benign	Het
Wdr24	A	T	17: 25,827,986	Q671L	probably benign	Het
Zfp110	C	T	7: 12,848,478	T351I	probably benign	Het
Zfp963	T	C	8: 69,743,377	D142G	probably benign	Het

Other mutations in Ino80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01404:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01985:Ino80	APN	2	119433321	missense	probably damaging	0.99
IGL02039:Ino80	APN	2	119380073	missense	probably damaging	1.00
IGL02187:Ino80	APN	2	119445457	splice site	probably benign
IGL02726:Ino80	APN	2	119442483	missense	probably damaging	1.00
Chosen	UTSW	2	119382269	splice site	probably null
PIT4677001:Ino80	UTSW	2	119377545	missense	probably benign
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0057:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0113:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0114:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0115:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0138:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0189:Ino80	UTSW	2	119379679	missense	probably benign	0.36
R0363:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0364:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0365:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0481:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0532:Ino80	UTSW	2	119381983	missense	possibly damaging	0.79
R0580:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R0610:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0675:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R1275:Ino80	UTSW	2	119427055	missense	probably benign	0.12
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1506:Ino80	UTSW	2	119425265	nonsense	probably null
R1510:Ino80	UTSW	2	119450049	missense	probably damaging	1.00
R1570:Ino80	UTSW	2	119447028	missense	possibly damaging	0.68
R1613:Ino80	UTSW	2	119392867	missense	probably damaging	1.00
R1673:Ino80	UTSW	2	119381936	missense	probably damaging	1.00
R1773:Ino80	UTSW	2	119418409	missense	probably benign	0.18
R1795:Ino80	UTSW	2	119406859	missense	probably damaging	1.00
R2093:Ino80	UTSW	2	119426670	missense	possibly damaging	0.55
R2105:Ino80	UTSW	2	119431929	missense	probably null	1.00
R2113:Ino80	UTSW	2	119454084	missense	probably damaging	1.00
R3618:Ino80	UTSW	2	119446872	missense	probably null	0.81
R4572:Ino80	UTSW	2	119402358	missense	probably damaging	1.00
R4649:Ino80	UTSW	2	119431008	missense	probably damaging	1.00
R4919:Ino80	UTSW	2	119442592	missense	probably damaging	1.00
R5113:Ino80	UTSW	2	119431945	missense	probably damaging	1.00
R5138:Ino80	UTSW	2	119383421	missense	probably damaging	1.00
R5458:Ino80	UTSW	2	119412429	missense	possibly damaging	0.50
R5499:Ino80	UTSW	2	119441647	missense	probably damaging	1.00
R5502:Ino80	UTSW	2	119402396	missense	probably damaging	1.00
R5531:Ino80	UTSW	2	119445575	missense	probably benign
R5740:Ino80	UTSW	2	119431029	missense	probably damaging	1.00
R5914:Ino80	UTSW	2	119458216	missense	probably damaging	0.99
R6000:Ino80	UTSW	2	119374508	missense	probably benign	0.04
R6263:Ino80	UTSW	2	119383414	missense	probably damaging	1.00
R6505:Ino80	UTSW	2	119451441	missense	probably damaging	1.00
R6942:Ino80	UTSW	2	119383502	missense	probably damaging	0.99
R7052:Ino80	UTSW	2	119426587	critical splice donor site	probably null
R7100:Ino80	UTSW	2	119374513	missense	possibly damaging	0.47
R7163:Ino80	UTSW	2	119392875	missense	probably damaging	1.00
R7187:Ino80	UTSW	2	119426591	missense	probably benign	0.00
R7202:Ino80	UTSW	2	119374437	missense	probably benign	0.00
R7218:Ino80	UTSW	2	119458127	missense	probably benign
R7389:Ino80	UTSW	2	119442529	missense	probably benign	0.00
R7419:Ino80	UTSW	2	119380014	missense	probably benign	0.00
R7437:Ino80	UTSW	2	119442586	missense	possibly damaging	0.86
R7607:Ino80	UTSW	2	119382269	splice site	probably null
R7702:Ino80	UTSW	2	119442573	missense	probably benign	0.01
R7975:Ino80	UTSW	2	119456467	splice site	probably null
R7978:Ino80	UTSW	2	119439393	missense	possibly damaging	0.93
R8376:Ino80	UTSW	2	119442487	missense	probably benign	0.14
R8469:Ino80	UTSW	2	119379593	missense	probably benign
R8720:Ino80	UTSW	2	119402387	missense	probably damaging	1.00
R8751:Ino80	UTSW	2	119406908	missense	probably benign
R8958:Ino80	UTSW	2	119383381	missense	probably damaging	1.00
R8992:Ino80	UTSW	2	119379578	missense	possibly damaging	0.93
R9319:Ino80	UTSW	2	119374524	missense	probably benign	0.13
R9346:Ino80	UTSW	2	119426958	missense	possibly damaging	0.54
R9370:Ino80	UTSW	2	119402367	missense	probably damaging	1.00
R9621:Ino80	UTSW	2	119450015	missense	probably damaging	0.98
R9641:Ino80	UTSW	2	119445484	missense	probably benign	0.08
R9650:Ino80	UTSW	2	119446983	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTAAACAAGGGTCAGAAAGCTTATCT -3'
(R):5'- GTCATGCACATGTTATGAATGAAATT -3'

Sequencing Primer
(F):5'- GGGTCAGAAAGCTTATCTTAAAGAAC -3'
(R):5'- TTAAGACCCAAAAGTCACGAGTGTC -3'

Posted On

2017-02-15