Incidental Mutation 'R5892:Mfsd1'
ID457233
Institutional Source Beutler Lab
Gene Symbol Mfsd1
Ensembl Gene ENSMUSG00000027775
Gene Namemajor facilitator superfamily domain containing 1
Synonyms1200003O06Rik
MMRRC Submission 044093-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R5892 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location67582741-67604237 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 67589829 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029344]
Predicted Effect probably null
Transcript: ENSMUST00000029344
SMART Domains Protein: ENSMUSP00000029344
Gene: ENSMUSG00000027775

DomainStartEndE-ValueType
Pfam:MFS_1 45 404 2.3e-31 PFAM
Pfam:MFS_2 175 443 2.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192776
Meta Mutation Damage Score 0.9595 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik G T 5: 99,979,265 probably benign Het
Abcb11 C T 2: 69,261,500 A893T probably damaging Het
Adtrp A T 13: 41,828,206 N30K probably benign Het
Alms1 T A 6: 85,620,903 S904T probably damaging Het
Cep170 T A 1: 176,755,387 probably null Het
Cntnap3 A G 13: 64,799,180 V145A probably damaging Het
Dclre1a T C 19: 56,547,140 E4G probably benign Het
Depdc1a G C 3: 159,526,669 A686P probably damaging Het
Dnah7b T C 1: 46,337,593 probably null Het
Enox1 A G 14: 77,486,017 probably benign Het
Fam107b A G 2: 3,778,564 E268G probably damaging Het
Fer1l6 A G 15: 58,564,068 S437G probably benign Het
Flnb C A 14: 7,907,183 T1252K probably damaging Het
Fubp1 A G 3: 152,218,314 probably benign Het
Gm20402 G A 3: 52,268,949 A50T probably benign Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gzmk C T 13: 113,173,922 probably null Het
Ino80 A T 2: 119,439,547 probably benign Het
Ints8 T C 4: 11,223,813 T677A probably damaging Het
Kat6a A G 8: 22,938,289 E1220G probably damaging Het
Lrfn5 A G 12: 61,843,418 T498A probably damaging Het
Lrp2 T A 2: 69,442,776 T4043S probably benign Het
Malrd1 A G 2: 15,614,267 N314S probably benign Het
Muc1 C T 3: 89,230,993 P381S probably benign Het
Myh2 A T 11: 67,185,176 K730* probably null Het
Nat3 T A 8: 67,547,938 N156K probably benign Het
Nelfe T C 17: 34,854,669 probably benign Het
Nlrp1a A T 11: 71,099,645 L927Q probably damaging Het
P4ha2 A G 11: 54,120,188 Y343C probably damaging Het
Pclo A T 5: 14,521,171 Q190L probably damaging Het
Pde8a A G 7: 81,295,691 N183S probably damaging Het
Plekha2 C T 8: 25,052,365 V278I probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plxnb1 T C 9: 109,111,707 L1550P probably damaging Het
Ppox C T 1: 171,277,461 V385I probably damaging Het
Prdm16 T C 4: 154,323,259 D1170G possibly damaging Het
Prmt5 A T 14: 54,509,911 S470T probably damaging Het
Robo2 T A 16: 73,895,780 probably benign Het
Siglecg G A 7: 43,412,204 probably benign Het
Slc30a5 T C 13: 100,813,302 N367S probably damaging Het
Tex29 C T 8: 11,854,288 probably benign Het
Tmem117 T A 15: 94,638,139 V18E probably damaging Het
Tmtc2 C T 10: 105,413,505 M122I probably benign Het
Tpr T A 1: 150,407,400 N287K probably benign Het
Unc93b1 A T 19: 3,943,632 D358V probably damaging Het
Vrk2 A T 11: 26,534,372 probably benign Het
Wdr24 A T 17: 25,827,986 Q671L probably benign Het
Zfp110 C T 7: 12,848,478 T351I probably benign Het
Zfp963 T C 8: 69,743,377 D142G probably benign Het
Other mutations in Mfsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01781:Mfsd1 APN 3 67587911 splice site probably benign
IGL02186:Mfsd1 APN 3 67596595 missense probably benign 0.00
IGL02209:Mfsd1 APN 3 67598132 splice site probably benign
IGL02293:Mfsd1 APN 3 67598092 missense probably damaging 1.00
IGL03132:Mfsd1 APN 3 67587940 missense possibly damaging 0.53
edelweiss UTSW 3 67596603 nonsense probably null
Schneeweiss UTSW 3 67585662 missense possibly damaging 0.79
white UTSW 3 67589829 critical splice acceptor site probably null
R0948:Mfsd1 UTSW 3 67596734 missense possibly damaging 0.61
R2355:Mfsd1 UTSW 3 67601335 missense probably damaging 1.00
R3407:Mfsd1 UTSW 3 67596713 missense possibly damaging 0.70
R3408:Mfsd1 UTSW 3 67596713 missense possibly damaging 0.70
R3729:Mfsd1 UTSW 3 67582965 missense probably benign 0.03
R3749:Mfsd1 UTSW 3 67582953 missense probably benign 0.09
R4405:Mfsd1 UTSW 3 67600610 missense probably benign 0.07
R4867:Mfsd1 UTSW 3 67587987 critical splice donor site probably null
R5429:Mfsd1 UTSW 3 67599960 missense probably damaging 1.00
R5456:Mfsd1 UTSW 3 67589833 missense probably benign 0.28
R6091:Mfsd1 UTSW 3 67599937 splice site probably null
R6120:Mfsd1 UTSW 3 67594385 nonsense probably null
R6671:Mfsd1 UTSW 3 67585662 missense possibly damaging 0.79
R6752:Mfsd1 UTSW 3 67596603 nonsense probably null
R6799:Mfsd1 UTSW 3 67599981 missense probably damaging 0.97
R7117:Mfsd1 UTSW 3 67600058 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTCAGTTGCCATCTTTGTCATG -3'
(R):5'- ACTTCTTCACATCCAAGTGTGC -3'

Sequencing Primer
(F):5'- GTCATGCTCATGGTCACACAG -3'
(R):5'- ACATCCAAGTGTGCTCTAGC -3'
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.

 

PCR Primers

R5892-Mfsd1_PCR_F: 5’- GTCAGTTGCCATCTTTGTCATG-3’

R5892-Mfsd1_PCR_R: 5’- ACTTCTTCACATCCAAGTGTGC-3’

 

Sequencing Primers

R5892-Mfsd1_SEQ_F: 5’- GTCATGCTCATGGTCACACAG-3’
 

R5892-Mfsd1_SEQ_R: 5’- ACATCCAAGTGTGCTCTAGC-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 406 nucleotides is amplified:

 

3361                                                               gtc     

3421 agttgccatc tttgtcatgc tcatggtcac acagtcttgc ttcactgtgt cttactggct     

3481 gaagccctta agctctcctc cattcaagaa gagacagaaa tcccacttct ctctgggagg     

3541 aagaaaatgg ctaactggga tttctttcaa agctctgact tttcttcttc tacatttagg     

3601 attggtggag agtccttagc agttgcccag aatacatatg ctgtgagttg gtttaaaggc     

3661 aaagaattaa acctggtgtt tggacttcaa ctcagcatgg ccagaattgt aagtatggtg     

3721 acggacgtgg tggggcccaa taggaagcac gagactgagt cttgtagtga tctcttcagt     

3781 catagaaaga agtgtgctag agcacacttg gatgtgaaga agt

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = A>G).

Posted On2017-02-15