Incidental Mutation 'R5892:Depdc1a'
ID457237
Institutional Source Beutler Lab
Gene Symbol Depdc1a
Ensembl Gene ENSMUSG00000028175
Gene NameDEP domain containing 1a
Synonyms5830484J08Rik
MMRRC Submission 044093-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R5892 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location159495433-159529955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 159526669 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Proline at position 686 (A686P)
Ref Sequence ENSEMBL: ENSMUSP00000113216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029825] [ENSMUST00000106041] [ENSMUST00000120272]
Predicted Effect probably damaging
Transcript: ENSMUST00000029825
AA Change: A686P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029825
Gene: ENSMUSG00000028175
AA Change: A686P

DomainStartEndE-ValueType
DEP 24 108 3.51e-24 SMART
low complexity region 505 524 N/A INTRINSIC
low complexity region 542 553 N/A INTRINSIC
SCOP:d1f7ca_ 584 680 3e-9 SMART
low complexity region 745 762 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106041
AA Change: A409P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101656
Gene: ENSMUSG00000028175
AA Change: A409P

DomainStartEndE-ValueType
DEP 24 108 3.51e-24 SMART
Pfam:RhoGAP 251 357 2.3e-11 PFAM
coiled coil region 460 488 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120272
AA Change: A686P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113216
Gene: ENSMUSG00000028175
AA Change: A686P

DomainStartEndE-ValueType
DEP 24 108 3.51e-24 SMART
low complexity region 505 524 N/A INTRINSIC
low complexity region 542 553 N/A INTRINSIC
SCOP:d1f7ca_ 584 680 4e-9 SMART
coiled coil region 737 765 N/A INTRINSIC
Meta Mutation Damage Score 0.4410 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik G T 5: 99,979,265 probably benign Het
Abcb11 C T 2: 69,261,500 A893T probably damaging Het
Adtrp A T 13: 41,828,206 N30K probably benign Het
Alms1 T A 6: 85,620,903 S904T probably damaging Het
Cep170 T A 1: 176,755,387 probably null Het
Cntnap3 A G 13: 64,799,180 V145A probably damaging Het
Dclre1a T C 19: 56,547,140 E4G probably benign Het
Dnah7b T C 1: 46,337,593 probably null Het
Enox1 A G 14: 77,486,017 probably benign Het
Fam107b A G 2: 3,778,564 E268G probably damaging Het
Fer1l6 A G 15: 58,564,068 S437G probably benign Het
Flnb C A 14: 7,907,183 T1252K probably damaging Het
Fubp1 A G 3: 152,218,314 probably benign Het
Gm20402 G A 3: 52,268,949 A50T probably benign Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gzmk C T 13: 113,173,922 probably null Het
Ino80 A T 2: 119,439,547 probably benign Het
Ints8 T C 4: 11,223,813 T677A probably damaging Het
Kat6a A G 8: 22,938,289 E1220G probably damaging Het
Lrfn5 A G 12: 61,843,418 T498A probably damaging Het
Lrp2 T A 2: 69,442,776 T4043S probably benign Het
Malrd1 A G 2: 15,614,267 N314S probably benign Het
Mfsd1 A G 3: 67,589,829 probably null Het
Muc1 C T 3: 89,230,993 P381S probably benign Het
Myh2 A T 11: 67,185,176 K730* probably null Het
Nat3 T A 8: 67,547,938 N156K probably benign Het
Nelfe T C 17: 34,854,669 probably benign Het
Nlrp1a A T 11: 71,099,645 L927Q probably damaging Het
P4ha2 A G 11: 54,120,188 Y343C probably damaging Het
Pclo A T 5: 14,521,171 Q190L probably damaging Het
Pde8a A G 7: 81,295,691 N183S probably damaging Het
Plekha2 C T 8: 25,052,365 V278I probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plxnb1 T C 9: 109,111,707 L1550P probably damaging Het
Ppox C T 1: 171,277,461 V385I probably damaging Het
Prdm16 T C 4: 154,323,259 D1170G possibly damaging Het
Prmt5 A T 14: 54,509,911 S470T probably damaging Het
Robo2 T A 16: 73,895,780 probably benign Het
Siglecg G A 7: 43,412,204 probably benign Het
Slc30a5 T C 13: 100,813,302 N367S probably damaging Het
Tex29 C T 8: 11,854,288 probably benign Het
Tmem117 T A 15: 94,638,139 V18E probably damaging Het
Tmtc2 C T 10: 105,413,505 M122I probably benign Het
Tpr T A 1: 150,407,400 N287K probably benign Het
Unc93b1 A T 19: 3,943,632 D358V probably damaging Het
Vrk2 A T 11: 26,534,372 probably benign Het
Wdr24 A T 17: 25,827,986 Q671L probably benign Het
Zfp110 C T 7: 12,848,478 T351I probably benign Het
Zfp963 T C 8: 69,743,377 D142G probably benign Het
Other mutations in Depdc1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Depdc1a APN 3 159522738 nonsense probably null
IGL00581:Depdc1a APN 3 159526552 missense probably benign 0.12
IGL00961:Depdc1a APN 3 159523814 missense possibly damaging 0.79
IGL01530:Depdc1a APN 3 159523923 missense probably damaging 1.00
IGL01567:Depdc1a APN 3 159526546 missense probably damaging 1.00
IGL02320:Depdc1a APN 3 159516933 missense probably damaging 0.99
IGL02622:Depdc1a APN 3 159515510 missense probably benign 0.02
IGL02647:Depdc1a APN 3 159522866 missense probably damaging 1.00
P0033:Depdc1a UTSW 3 159516141 missense probably damaging 0.99
P4717OSA:Depdc1a UTSW 3 159522547 missense probably damaging 1.00
P4748:Depdc1a UTSW 3 159522547 missense probably damaging 1.00
R0220:Depdc1a UTSW 3 159523905 missense probably benign 0.06
R0454:Depdc1a UTSW 3 159516900 splice site probably null
R0479:Depdc1a UTSW 3 159520860 missense probably damaging 1.00
R1317:Depdc1a UTSW 3 159523287 missense probably damaging 1.00
R1452:Depdc1a UTSW 3 159526691 missense possibly damaging 0.88
R1567:Depdc1a UTSW 3 159522540 missense possibly damaging 0.86
R1669:Depdc1a UTSW 3 159522924 missense probably benign 0.07
R1751:Depdc1a UTSW 3 159523287 missense probably damaging 1.00
R2332:Depdc1a UTSW 3 159523866 missense probably damaging 1.00
R4023:Depdc1a UTSW 3 159516149 splice site probably null
R4254:Depdc1a UTSW 3 159498487 missense probably damaging 0.99
R4551:Depdc1a UTSW 3 159522584 missense probably damaging 1.00
R4780:Depdc1a UTSW 3 159526706 missense probably benign 0.00
R4782:Depdc1a UTSW 3 159526636 missense probably damaging 1.00
R4866:Depdc1a UTSW 3 159516127 missense probably damaging 0.96
R4981:Depdc1a UTSW 3 159523913 missense probably benign 0.14
R5100:Depdc1a UTSW 3 159515520 missense probably benign 0.06
R5326:Depdc1a UTSW 3 159526649 missense probably damaging 1.00
R5367:Depdc1a UTSW 3 159523954 splice site probably null
R6314:Depdc1a UTSW 3 159498414 missense probably damaging 1.00
R6467:Depdc1a UTSW 3 159516042 missense probably benign 0.00
R6674:Depdc1a UTSW 3 159526707 missense probably benign 0.00
R7061:Depdc1a UTSW 3 159522852 missense possibly damaging 0.74
R7366:Depdc1a UTSW 3 159523212 missense probably benign 0.00
R7531:Depdc1a UTSW 3 159522639 missense probably damaging 1.00
R7886:Depdc1a UTSW 3 159516069 missense probably benign 0.04
R7969:Depdc1a UTSW 3 159516069 missense probably benign 0.04
X0026:Depdc1a UTSW 3 159498631 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTCTGTTAATGGAAGCTGTGAC -3'
(R):5'- CCAGGCTCCATACATTCCTG -3'

Sequencing Primer
(F):5'- TGACCCATTAGAATTTTGCTAACAC -3'
(R):5'- CCATACATTCCTGACTTTGAGAATGC -3'
Posted On2017-02-15