Incidental Mutation 'R5892:Alms1'
ID 457241
Institutional Source Beutler Lab
Gene Symbol Alms1
Ensembl Gene ENSMUSG00000063810
Gene Name ALMS1, centrosome and basal body associated
Synonyms
MMRRC Submission 044093-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5892 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 85587531-85702753 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 85620903 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 904 (S904T)
Ref Sequence ENSEMBL: ENSMUSP00000071904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072018] [ENSMUST00000213058]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000072018
AA Change: S904T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071904
Gene: ENSMUSG00000063810
AA Change: S904T

DomainStartEndE-ValueType
coiled coil region 10 39 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
Blast:MYSc 127 233 1e-21 BLAST
internal_repeat_3 408 511 2.48e-7 PROSPERO
internal_repeat_2 414 804 2.09e-12 PROSPERO
internal_repeat_1 438 834 4.54e-18 PROSPERO
internal_repeat_3 652 757 2.48e-7 PROSPERO
low complexity region 903 908 N/A INTRINSIC
internal_repeat_1 916 1385 4.54e-18 PROSPERO
internal_repeat_2 1024 1390 2.09e-12 PROSPERO
low complexity region 1572 1586 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2760 2773 N/A INTRINSIC
low complexity region 2950 2968 N/A INTRINSIC
low complexity region 3013 3030 N/A INTRINSIC
Pfam:ALMS_motif 3125 3247 1.8e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213058
AA Change: S1373T

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a large tandem-repeat domain as well as additional low complexity regions. The encoded protein functions in microtubule organization, particularly in the formation and maintanance of cilia. Mutations in this gene cause Alstrom syndrome. There is a pseudogene for this gene located adjacent in the same region of chromosome 2. Alternative splice variants have been described but their full length nature has not been determined. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous null mice display obesity starting after puberty, hypogonadism, hyperinsulinemia, male-specific hyperglycemia, retinal dysfunction, and late-onset hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik G T 5: 99,979,265 probably benign Het
Abcb11 C T 2: 69,261,500 A893T probably damaging Het
Adtrp A T 13: 41,828,206 N30K probably benign Het
Cep170 T A 1: 176,755,387 probably null Het
Cntnap3 A G 13: 64,799,180 V145A probably damaging Het
Dclre1a T C 19: 56,547,140 E4G probably benign Het
Depdc1a G C 3: 159,526,669 A686P probably damaging Het
Dnah7b T C 1: 46,337,593 probably null Het
Enox1 A G 14: 77,486,017 probably benign Het
Fam107b A G 2: 3,778,564 E268G probably damaging Het
Fer1l6 A G 15: 58,564,068 S437G probably benign Het
Flnb C A 14: 7,907,183 T1252K probably damaging Het
Fubp1 A G 3: 152,218,314 probably benign Het
Gm20402 G A 3: 52,268,949 A50T probably benign Het
Gpr137b T C 13: 13,359,406 Y355C Het
Gzmk C T 13: 113,173,922 probably null Het
Ino80 A T 2: 119,439,547 probably benign Het
Ints8 T C 4: 11,223,813 T677A probably damaging Het
Kat6a A G 8: 22,938,289 E1220G probably damaging Het
Lrfn5 A G 12: 61,843,418 T498A probably damaging Het
Lrp2 T A 2: 69,442,776 T4043S probably benign Het
Malrd1 A G 2: 15,614,267 N314S probably benign Het
Mfsd1 A G 3: 67,589,829 probably null Het
Muc1 C T 3: 89,230,993 P381S probably benign Het
Myh2 A T 11: 67,185,176 K730* probably null Het
Nat3 T A 8: 67,547,938 N156K probably benign Het
Nelfe T C 17: 34,854,669 probably benign Het
Nlrp1a A T 11: 71,099,645 L927Q probably damaging Het
P4ha2 A G 11: 54,120,188 Y343C probably damaging Het
Pclo A T 5: 14,521,171 Q190L probably damaging Het
Pde8a A G 7: 81,295,691 N183S probably damaging Het
Plekha2 C T 8: 25,052,365 V278I probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plxnb1 T C 9: 109,111,707 L1550P probably damaging Het
Ppox C T 1: 171,277,461 V385I probably damaging Het
Prdm16 T C 4: 154,323,259 D1170G possibly damaging Het
Prmt5 A T 14: 54,509,911 S470T probably damaging Het
Robo2 T A 16: 73,895,780 probably benign Het
Siglecg G A 7: 43,412,204 probably benign Het
Slc30a5 T C 13: 100,813,302 N367S probably damaging Het
Tex29 C T 8: 11,854,288 probably benign Het
Tmem117 T A 15: 94,638,139 V18E probably damaging Het
Tmtc2 C T 10: 105,413,505 M122I probably benign Het
Tpr T A 1: 150,407,400 N287K probably benign Het
Unc93b1 A T 19: 3,943,632 D358V probably damaging Het
Vrk2 A T 11: 26,534,372 probably benign Het
Wdr24 A T 17: 25,827,986 Q671L probably benign Het
Zfp110 C T 7: 12,848,478 T351I probably benign Het
Zfp963 T C 8: 69,743,377 D142G probably benign Het
Other mutations in Alms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Alms1 APN 6 85677964 missense probably damaging 1.00
IGL00331:Alms1 APN 6 85641371 missense possibly damaging 0.94
IGL00658:Alms1 APN 6 85628961 missense probably damaging 1.00
IGL00835:Alms1 APN 6 85622134 missense probably damaging 1.00
IGL00930:Alms1 APN 6 85601310 missense probably damaging 0.98
IGL01446:Alms1 APN 6 85696701 missense probably damaging 1.00
IGL01448:Alms1 APN 6 85677899 missense possibly damaging 0.93
IGL01563:Alms1 APN 6 85627983 missense probably damaging 1.00
IGL01632:Alms1 APN 6 85627946 missense probably benign 0.07
IGL01651:Alms1 APN 6 85656476 missense probably benign 0.05
IGL01670:Alms1 APN 6 85678150 missense probably benign 0.00
IGL01716:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01719:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01720:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01723:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01877:Alms1 APN 6 85622411 missense possibly damaging 0.55
IGL01919:Alms1 APN 6 85628004 missense possibly damaging 0.77
IGL01976:Alms1 APN 6 85622665 missense possibly damaging 0.73
IGL02003:Alms1 APN 6 85622223 missense possibly damaging 0.54
IGL02069:Alms1 APN 6 85628823 missense probably benign 0.12
IGL02070:Alms1 APN 6 85651403 missense possibly damaging 0.74
IGL02079:Alms1 APN 6 85628634 missense probably damaging 0.98
IGL02081:Alms1 APN 6 85620303 missense possibly damaging 0.55
IGL02379:Alms1 APN 6 85629633 missense probably damaging 0.98
IGL02412:Alms1 APN 6 85628872 missense possibly damaging 0.91
IGL02606:Alms1 APN 6 85599967 missense probably benign
IGL02636:Alms1 APN 6 85628654 missense probably benign 0.28
IGL02702:Alms1 APN 6 85599849 missense probably benign 0.12
IGL02815:Alms1 APN 6 85667957 critical splice donor site probably null
IGL02926:Alms1 APN 6 85641450 missense probably damaging 1.00
IGL02945:Alms1 APN 6 85620933 missense probably damaging 0.96
IGL02959:Alms1 APN 6 85629052 nonsense probably null
IGL03124:Alms1 APN 6 85678419 missense probably benign 0.03
IGL03199:Alms1 APN 6 85622497 missense possibly damaging 0.68
IGL03209:Alms1 APN 6 85599973 splice site probably benign
IGL03247:Alms1 APN 6 85678597 missense possibly damaging 0.85
ares UTSW 6 85621275 nonsense probably null
ares2 UTSW 6 85677990 nonsense probably null
butterball UTSW 6 85696771 missense probably damaging 0.99
earthquake UTSW 6 85628735 nonsense probably null
fatty UTSW 6 85627934 nonsense probably null
gut_check UTSW 6 85620369 nonsense probably null
portly UTSW 6 85619712 missense probably benign 0.00
replete UTSW 6 85629208 missense possibly damaging 0.87
PIT4468001:Alms1 UTSW 6 85624719 critical splice donor site probably null
R0003:Alms1 UTSW 6 85629210 missense possibly damaging 0.90
R0095:Alms1 UTSW 6 85620253 missense possibly damaging 0.90
R0110:Alms1 UTSW 6 85620369 nonsense probably null
R0114:Alms1 UTSW 6 85619803 missense probably benign 0.00
R0153:Alms1 UTSW 6 85641381 missense possibly damaging 0.94
R0217:Alms1 UTSW 6 85622930 missense probably damaging 0.99
R0328:Alms1 UTSW 6 85610814 splice site probably null
R0410:Alms1 UTSW 6 85587803 missense unknown
R0469:Alms1 UTSW 6 85620369 nonsense probably null
R0491:Alms1 UTSW 6 85702600 missense probably damaging 0.98
R0510:Alms1 UTSW 6 85620369 nonsense probably null
R0522:Alms1 UTSW 6 85621615 missense probably benign
R0525:Alms1 UTSW 6 85587760 missense unknown
R0611:Alms1 UTSW 6 85678671 missense possibly damaging 0.61
R0637:Alms1 UTSW 6 85623033 missense possibly damaging 0.85
R0718:Alms1 UTSW 6 85621821 missense probably benign 0.00
R0831:Alms1 UTSW 6 85628520 missense probably benign 0.00
R1318:Alms1 UTSW 6 85628549 missense possibly damaging 0.62
R1340:Alms1 UTSW 6 85667957 critical splice donor site probably null
R1561:Alms1 UTSW 6 85629052 nonsense probably null
R1648:Alms1 UTSW 6 85678402 missense probably damaging 0.99
R1697:Alms1 UTSW 6 85622454 missense possibly damaging 0.94
R1699:Alms1 UTSW 6 85622880 missense possibly damaging 0.46
R1715:Alms1 UTSW 6 85629052 nonsense probably null
R1723:Alms1 UTSW 6 85628753 missense probably damaging 1.00
R1734:Alms1 UTSW 6 85641550 critical splice donor site probably null
R1758:Alms1 UTSW 6 85628505 missense probably damaging 0.99
R1804:Alms1 UTSW 6 85621275 nonsense probably null
R1835:Alms1 UTSW 6 85678503 missense possibly damaging 0.94
R1836:Alms1 UTSW 6 85678503 missense possibly damaging 0.94
R2077:Alms1 UTSW 6 85622309 missense possibly damaging 0.93
R2246:Alms1 UTSW 6 85622967 missense possibly damaging 0.91
R2254:Alms1 UTSW 6 85619848 missense probably damaging 1.00
R2280:Alms1 UTSW 6 85677973 missense probably damaging 0.99
R2516:Alms1 UTSW 6 85667963 splice site probably benign
R2519:Alms1 UTSW 6 85667963 splice site probably benign
R2566:Alms1 UTSW 6 85622482 missense possibly damaging 0.84
R2850:Alms1 UTSW 6 85621299 missense probably benign 0.00
R2850:Alms1 UTSW 6 85667963 splice site probably benign
R2932:Alms1 UTSW 6 85620562 missense possibly damaging 0.89
R2944:Alms1 UTSW 6 85628391 missense probably damaging 1.00
R2980:Alms1 UTSW 6 85628835 missense probably damaging 1.00
R3084:Alms1 UTSW 6 85678140 missense probably benign
R3086:Alms1 UTSW 6 85678140 missense probably benign
R3122:Alms1 UTSW 6 85667963 splice site probably benign
R3404:Alms1 UTSW 6 85667963 splice site probably benign
R3405:Alms1 UTSW 6 85667963 splice site probably benign
R3804:Alms1 UTSW 6 85619647 missense probably damaging 1.00
R3904:Alms1 UTSW 6 85621678 missense probably benign 0.00
R4014:Alms1 UTSW 6 85678352 missense probably benign 0.41
R4056:Alms1 UTSW 6 85587803 missense unknown
R4067:Alms1 UTSW 6 85621289 missense probably damaging 1.00
R4110:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4111:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4112:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4194:Alms1 UTSW 6 85677990 nonsense probably null
R4464:Alms1 UTSW 6 85620021 missense possibly damaging 0.66
R4539:Alms1 UTSW 6 85620478 missense possibly damaging 0.78
R4554:Alms1 UTSW 6 85624617 missense probably benign
R4696:Alms1 UTSW 6 85620522 missense probably damaging 1.00
R4825:Alms1 UTSW 6 85678245 missense probably damaging 0.99
R4921:Alms1 UTSW 6 85628546 missense probably benign 0.13
R5030:Alms1 UTSW 6 85627964 missense probably damaging 0.98
R5051:Alms1 UTSW 6 85627934 nonsense probably null
R5085:Alms1 UTSW 6 85620732 missense possibly damaging 0.55
R5141:Alms1 UTSW 6 85621432 missense probably benign 0.01
R5233:Alms1 UTSW 6 85656371 splice site probably null
R5310:Alms1 UTSW 6 85615368 missense possibly damaging 0.79
R5344:Alms1 UTSW 6 85696789 missense probably benign 0.04
R5394:Alms1 UTSW 6 85623088 missense probably benign 0.01
R5460:Alms1 UTSW 6 85696731 missense probably benign 0.08
R5558:Alms1 UTSW 6 85641329 nonsense probably null
R5650:Alms1 UTSW 6 85620271 missense probably damaging 1.00
R5667:Alms1 UTSW 6 85696771 missense probably damaging 0.99
R5671:Alms1 UTSW 6 85629208 missense possibly damaging 0.87
R5688:Alms1 UTSW 6 85599895 missense possibly damaging 0.92
R5815:Alms1 UTSW 6 85622838 missense probably damaging 0.99
R5947:Alms1 UTSW 6 85619712 missense probably benign 0.00
R6031:Alms1 UTSW 6 85622955 missense probably damaging 1.00
R6031:Alms1 UTSW 6 85622955 missense probably damaging 1.00
R6144:Alms1 UTSW 6 85623074 missense probably damaging 0.98
R6258:Alms1 UTSW 6 85628735 nonsense probably null
R6260:Alms1 UTSW 6 85628735 nonsense probably null
R6455:Alms1 UTSW 6 85696657 missense probably damaging 0.99
R6569:Alms1 UTSW 6 85641339 missense probably benign 0.07
R6637:Alms1 UTSW 6 85619734 missense possibly damaging 0.78
R6866:Alms1 UTSW 6 85621098 missense possibly damaging 0.85
R6918:Alms1 UTSW 6 85622661 missense possibly damaging 0.87
R7121:Alms1 UTSW 6 85624622 missense probably damaging 1.00
R7179:Alms1 UTSW 6 85621369 missense probably benign 0.09
R7334:Alms1 UTSW 6 85641450 missense probably damaging 0.99
R7376:Alms1 UTSW 6 85622106 missense probably benign 0.10
R7394:Alms1 UTSW 6 85622223 missense possibly damaging 0.54
R7413:Alms1 UTSW 6 85628306 missense probably benign 0.03
R7511:Alms1 UTSW 6 85609425 missense unknown
R7542:Alms1 UTSW 6 85629362 missense possibly damaging 0.62
R7562:Alms1 UTSW 6 85620412 missense probably damaging 1.00
R7575:Alms1 UTSW 6 85622159 missense possibly damaging 0.49
R7577:Alms1 UTSW 6 85615320 missense probably benign 0.09
R7618:Alms1 UTSW 6 85678417 missense probably benign 0.07
R7653:Alms1 UTSW 6 85620595 missense possibly damaging 0.47
R7672:Alms1 UTSW 6 85615351 missense probably damaging 1.00
R7807:Alms1 UTSW 6 85622976 missense possibly damaging 0.91
R7815:Alms1 UTSW 6 85615358 missense probably benign 0.42
R7849:Alms1 UTSW 6 85621497 missense possibly damaging 0.48
R7944:Alms1 UTSW 6 85641380 missense probably benign 0.03
R7954:Alms1 UTSW 6 85621162 missense probably damaging 0.98
R7971:Alms1 UTSW 6 85628679 missense probably benign
R8048:Alms1 UTSW 6 85641334 missense probably benign 0.13
R8223:Alms1 UTSW 6 85643240 nonsense probably null
R8332:Alms1 UTSW 6 85620579 missense probably benign 0.05
R8374:Alms1 UTSW 6 85608991 missense probably benign 0.41
R8470:Alms1 UTSW 6 85641375 missense probably damaging 0.99
R8755:Alms1 UTSW 6 85621574 missense probably benign 0.01
R8979:Alms1 UTSW 6 85621027 missense probably damaging 0.98
R9044:Alms1 UTSW 6 85696753 missense probably damaging 0.98
R9057:Alms1 UTSW 6 85609832 missense unknown
R9224:Alms1 UTSW 6 85621788 missense possibly damaging 0.69
R9259:Alms1 UTSW 6 85667891 missense possibly damaging 0.94
R9401:Alms1 UTSW 6 85678019 nonsense probably null
R9459:Alms1 UTSW 6 85627964 missense probably damaging 0.98
R9633:Alms1 UTSW 6 85623143 missense probably damaging 0.99
R9716:Alms1 UTSW 6 85601252 missense possibly damaging 0.84
R9730:Alms1 UTSW 6 85629438 missense probably benign 0.00
R9790:Alms1 UTSW 6 85619443 missense probably benign 0.04
R9791:Alms1 UTSW 6 85619443 missense probably benign 0.04
R9802:Alms1 UTSW 6 85629238 missense possibly damaging 0.61
X0013:Alms1 UTSW 6 85656455 missense probably damaging 1.00
X0025:Alms1 UTSW 6 85620210 missense probably damaging 0.96
Z1176:Alms1 UTSW 6 85678418 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- GTTTTAGGGACTTCTGGACCAC -3'
(R):5'- TTGTGACCTTTAGTTCGCTGAC -3'

Sequencing Primer
(F):5'- TAGGGACTTCTGGACCACCTGAC -3'
(R):5'- AGTTCGCTGACTATCTGACATAGGC -3'
Posted On 2017-02-15