Incidental Mutation 'R5892:Pde8a'
ID457244
Institutional Source Beutler Lab
Gene Symbol Pde8a
Ensembl Gene ENSMUSG00000025584
Gene Namephosphodiesterase 8A
SynonymsPde8
MMRRC Submission 044093-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5892 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location81213596-81334533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81295691 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 183 (N183S)
Ref Sequence ENSEMBL: ENSMUSP00000026672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026672]
Predicted Effect probably damaging
Transcript: ENSMUST00000026672
AA Change: N183S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026672
Gene: ENSMUSG00000025584
AA Change: N183S

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
Blast:REC 79 194 2e-48 BLAST
PAS 211 277 2.18e-2 SMART
Blast:HDc 403 451 4e-11 BLAST
HDc 548 734 5.78e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128154
Meta Mutation Damage Score 0.0998 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE8 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Targeted disruption of this gene results in a 4-fold increase in basal release of testosterone in isolated Leydig cells as well as a significant increase in the sensitivity to luteinizing hormone, measured as testosterone released into the media. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik G T 5: 99,979,265 probably benign Het
Abcb11 C T 2: 69,261,500 A893T probably damaging Het
Adtrp A T 13: 41,828,206 N30K probably benign Het
Alms1 T A 6: 85,620,903 S904T probably damaging Het
Cep170 T A 1: 176,755,387 probably null Het
Cntnap3 A G 13: 64,799,180 V145A probably damaging Het
Dclre1a T C 19: 56,547,140 E4G probably benign Het
Depdc1a G C 3: 159,526,669 A686P probably damaging Het
Dnah7b T C 1: 46,337,593 probably null Het
Enox1 A G 14: 77,486,017 probably benign Het
Fam107b A G 2: 3,778,564 E268G probably damaging Het
Fer1l6 A G 15: 58,564,068 S437G probably benign Het
Flnb C A 14: 7,907,183 T1252K probably damaging Het
Fubp1 A G 3: 152,218,314 probably benign Het
Gm20402 G A 3: 52,268,949 A50T probably benign Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gzmk C T 13: 113,173,922 probably null Het
Ino80 A T 2: 119,439,547 probably benign Het
Ints8 T C 4: 11,223,813 T677A probably damaging Het
Kat6a A G 8: 22,938,289 E1220G probably damaging Het
Lrfn5 A G 12: 61,843,418 T498A probably damaging Het
Lrp2 T A 2: 69,442,776 T4043S probably benign Het
Malrd1 A G 2: 15,614,267 N314S probably benign Het
Mfsd1 A G 3: 67,589,829 probably null Het
Muc1 C T 3: 89,230,993 P381S probably benign Het
Myh2 A T 11: 67,185,176 K730* probably null Het
Nat3 T A 8: 67,547,938 N156K probably benign Het
Nelfe T C 17: 34,854,669 probably benign Het
Nlrp1a A T 11: 71,099,645 L927Q probably damaging Het
P4ha2 A G 11: 54,120,188 Y343C probably damaging Het
Pclo A T 5: 14,521,171 Q190L probably damaging Het
Plekha2 C T 8: 25,052,365 V278I probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plxnb1 T C 9: 109,111,707 L1550P probably damaging Het
Ppox C T 1: 171,277,461 V385I probably damaging Het
Prdm16 T C 4: 154,323,259 D1170G possibly damaging Het
Prmt5 A T 14: 54,509,911 S470T probably damaging Het
Robo2 T A 16: 73,895,780 probably benign Het
Siglecg G A 7: 43,412,204 probably benign Het
Slc30a5 T C 13: 100,813,302 N367S probably damaging Het
Tex29 C T 8: 11,854,288 probably benign Het
Tmem117 T A 15: 94,638,139 V18E probably damaging Het
Tmtc2 C T 10: 105,413,505 M122I probably benign Het
Tpr T A 1: 150,407,400 N287K probably benign Het
Unc93b1 A T 19: 3,943,632 D358V probably damaging Het
Vrk2 A T 11: 26,534,372 probably benign Het
Wdr24 A T 17: 25,827,986 Q671L probably benign Het
Zfp110 C T 7: 12,848,478 T351I probably benign Het
Zfp963 T C 8: 69,743,377 D142G probably benign Het
Other mutations in Pde8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Pde8a APN 7 81306708 missense possibly damaging 0.62
IGL00808:Pde8a APN 7 81283014 critical splice donor site probably null
IGL01134:Pde8a APN 7 81319078 missense possibly damaging 0.86
IGL01443:Pde8a APN 7 81324181 missense probably damaging 1.00
IGL02044:Pde8a APN 7 81317449 critical splice donor site probably null
IGL02269:Pde8a APN 7 81308802 splice site probably benign
IGL02528:Pde8a APN 7 81293189 splice site probably benign
IGL02738:Pde8a APN 7 81326342 missense probably damaging 1.00
IGL02937:Pde8a APN 7 81295771 splice site probably benign
IGL03072:Pde8a APN 7 81308809 missense probably damaging 1.00
cast_iron UTSW 7 81282807 splice site probably null
K7894:Pde8a UTSW 7 81306765 missense probably damaging 1.00
R0069:Pde8a UTSW 7 81319123 splice site probably benign
R0069:Pde8a UTSW 7 81319123 splice site probably benign
R0547:Pde8a UTSW 7 81324130 missense probably benign 0.00
R0552:Pde8a UTSW 7 81317347 missense probably benign 0.12
R1342:Pde8a UTSW 7 81302294 critical splice donor site probably null
R1469:Pde8a UTSW 7 81302271 missense probably damaging 1.00
R1469:Pde8a UTSW 7 81302271 missense probably damaging 1.00
R1502:Pde8a UTSW 7 81292259 missense probably damaging 1.00
R1568:Pde8a UTSW 7 81292263 missense probably damaging 1.00
R1768:Pde8a UTSW 7 81300723 splice site probably null
R2076:Pde8a UTSW 7 81308945 missense probably benign 0.11
R2165:Pde8a UTSW 7 81295768 critical splice donor site probably null
R2385:Pde8a UTSW 7 81282992 missense probably benign 0.45
R2518:Pde8a UTSW 7 81317422 missense probably benign 0.00
R4001:Pde8a UTSW 7 81317356 missense probably damaging 1.00
R4114:Pde8a UTSW 7 81282807 splice site probably null
R4115:Pde8a UTSW 7 81282807 splice site probably null
R4159:Pde8a UTSW 7 81320659 missense probably benign 0.13
R4299:Pde8a UTSW 7 81328035 missense probably benign
R4544:Pde8a UTSW 7 81328099 missense probably damaging 0.98
R4545:Pde8a UTSW 7 81328099 missense probably damaging 0.98
R4561:Pde8a UTSW 7 81308820 nonsense probably null
R4562:Pde8a UTSW 7 81308820 nonsense probably null
R4563:Pde8a UTSW 7 81308820 nonsense probably null
R4615:Pde8a UTSW 7 81320737 missense probably damaging 1.00
R4808:Pde8a UTSW 7 81282931 missense probably benign
R5396:Pde8a UTSW 7 81333422 missense probably damaging 1.00
R5840:Pde8a UTSW 7 81213965 missense probably benign
R6621:Pde8a UTSW 7 81293130 critical splice acceptor site probably null
R7067:Pde8a UTSW 7 81317326 missense probably benign 0.41
R7163:Pde8a UTSW 7 81306708 missense possibly damaging 0.62
R7483:Pde8a UTSW 7 81282833 missense probably benign 0.02
R7606:Pde8a UTSW 7 81332967 missense probably damaging 0.98
R7876:Pde8a UTSW 7 81324071 missense probably damaging 1.00
R8046:Pde8a UTSW 7 81308839 missense possibly damaging 0.90
R8046:Pde8a UTSW 7 81317370 missense probably benign 0.14
R8832:Pde8a UTSW 7 81306750 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GCCCTAGCTTTATAAATGACAGG -3'
(R):5'- ATCAGACATTGAGATGGATTCCAG -3'

Sequencing Primer
(F):5'- GCTTTATAAATGACAGGGAGATAACC -3'
(R):5'- TGAGTCAGAGTCTCCCTGAAC -3'
Posted On2017-02-15