Incidental Mutation 'R5892:Tmtc2'
ID457251
Institutional Source Beutler Lab
Gene Symbol Tmtc2
Ensembl Gene ENSMUSG00000036019
Gene Nametransmembrane and tetratricopeptide repeat containing 2
SynonymsD330034A10Rik, 8430438D04Rik
MMRRC Submission 044093-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R5892 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location105187663-105574451 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 105413505 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 122 (M122I)
Ref Sequence ENSEMBL: ENSMUSP00000061919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061506]
Predicted Effect probably benign
Transcript: ENSMUST00000061506
AA Change: M122I

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000061919
Gene: ENSMUSG00000036019
AA Change: M122I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 223 245 N/A INTRINSIC
Pfam:DUF1736 247 321 7.3e-33 PFAM
transmembrane domain 393 415 N/A INTRINSIC
transmembrane domain 425 444 N/A INTRINSIC
TPR 493 526 1.6e-3 SMART
TPR 527 560 6.84e-3 SMART
TPR 561 594 2.52e-1 SMART
TPR 606 639 3.12e-6 SMART
TPR 643 676 3.99e1 SMART
TPR 677 710 7.12e-1 SMART
low complexity region 729 739 N/A INTRINSIC
TPR 745 778 1.51e1 SMART
TPR 779 812 1.43e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143691
Meta Mutation Damage Score 0.0878 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integral membrane protein localized to the endoplasmic reticulum (ER). The encoded protein contains many tetratricopeptide repeats, sequences known for being involved in protein-protein interactions. This protein binds both the calcium uptake pump SERCA2B and the carbohydrate-binding chaperone calnexin, and it appears to play a role in calcium homeostasis in the ER. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik G T 5: 99,979,265 probably benign Het
Abcb11 C T 2: 69,261,500 A893T probably damaging Het
Adtrp A T 13: 41,828,206 N30K probably benign Het
Alms1 T A 6: 85,620,903 S904T probably damaging Het
Cep170 T A 1: 176,755,387 probably null Het
Cntnap3 A G 13: 64,799,180 V145A probably damaging Het
Dclre1a T C 19: 56,547,140 E4G probably benign Het
Depdc1a G C 3: 159,526,669 A686P probably damaging Het
Dnah7b T C 1: 46,337,593 probably null Het
Enox1 A G 14: 77,486,017 probably benign Het
Fam107b A G 2: 3,778,564 E268G probably damaging Het
Fer1l6 A G 15: 58,564,068 S437G probably benign Het
Flnb C A 14: 7,907,183 T1252K probably damaging Het
Fubp1 A G 3: 152,218,314 probably benign Het
Gm20402 G A 3: 52,268,949 A50T probably benign Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gzmk C T 13: 113,173,922 probably null Het
Ino80 A T 2: 119,439,547 probably benign Het
Ints8 T C 4: 11,223,813 T677A probably damaging Het
Kat6a A G 8: 22,938,289 E1220G probably damaging Het
Lrfn5 A G 12: 61,843,418 T498A probably damaging Het
Lrp2 T A 2: 69,442,776 T4043S probably benign Het
Malrd1 A G 2: 15,614,267 N314S probably benign Het
Mfsd1 A G 3: 67,589,829 probably null Het
Muc1 C T 3: 89,230,993 P381S probably benign Het
Myh2 A T 11: 67,185,176 K730* probably null Het
Nat3 T A 8: 67,547,938 N156K probably benign Het
Nelfe T C 17: 34,854,669 probably benign Het
Nlrp1a A T 11: 71,099,645 L927Q probably damaging Het
P4ha2 A G 11: 54,120,188 Y343C probably damaging Het
Pclo A T 5: 14,521,171 Q190L probably damaging Het
Pde8a A G 7: 81,295,691 N183S probably damaging Het
Plekha2 C T 8: 25,052,365 V278I probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plxnb1 T C 9: 109,111,707 L1550P probably damaging Het
Ppox C T 1: 171,277,461 V385I probably damaging Het
Prdm16 T C 4: 154,323,259 D1170G possibly damaging Het
Prmt5 A T 14: 54,509,911 S470T probably damaging Het
Robo2 T A 16: 73,895,780 probably benign Het
Siglecg G A 7: 43,412,204 probably benign Het
Slc30a5 T C 13: 100,813,302 N367S probably damaging Het
Tex29 C T 8: 11,854,288 probably benign Het
Tmem117 T A 15: 94,638,139 V18E probably damaging Het
Tpr T A 1: 150,407,400 N287K probably benign Het
Unc93b1 A T 19: 3,943,632 D358V probably damaging Het
Vrk2 A T 11: 26,534,372 probably benign Het
Wdr24 A T 17: 25,827,986 Q671L probably benign Het
Zfp110 C T 7: 12,848,478 T351I probably benign Het
Zfp963 T C 8: 69,743,377 D142G probably benign Het
Other mutations in Tmtc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Tmtc2 APN 10 105321446 missense possibly damaging 0.82
IGL01284:Tmtc2 APN 10 105271511 missense possibly damaging 0.56
IGL01317:Tmtc2 APN 10 105413785 missense probably damaging 1.00
IGL01327:Tmtc2 APN 10 105348479 missense probably benign 0.15
IGL01637:Tmtc2 APN 10 105370085 missense probably benign 0.00
IGL02176:Tmtc2 APN 10 105348493 missense probably benign 0.00
IGL02354:Tmtc2 APN 10 105271526 missense probably benign 0.00
IGL02361:Tmtc2 APN 10 105271526 missense probably benign 0.00
IGL02514:Tmtc2 APN 10 105190099 missense possibly damaging 0.94
IGL02540:Tmtc2 APN 10 105413339 missense probably benign 0.45
IGL02625:Tmtc2 APN 10 105370546 missense probably damaging 1.00
IGL02938:Tmtc2 APN 10 105413296 missense probably damaging 1.00
IGL02939:Tmtc2 APN 10 105370550 missense probably damaging 1.00
IGL03388:Tmtc2 APN 10 105321483 splice site probably benign
PIT4402001:Tmtc2 UTSW 10 105413407 missense probably damaging 1.00
PIT4449001:Tmtc2 UTSW 10 105303604 missense probably damaging 1.00
R1424:Tmtc2 UTSW 10 105413368 missense probably benign 0.00
R1462:Tmtc2 UTSW 10 105573705 nonsense probably null
R1462:Tmtc2 UTSW 10 105573705 nonsense probably null
R1529:Tmtc2 UTSW 10 105303658 missense probably damaging 1.00
R1903:Tmtc2 UTSW 10 105190108 missense probably benign 0.00
R2225:Tmtc2 UTSW 10 105370357 missense probably benign 0.22
R4280:Tmtc2 UTSW 10 105348433 critical splice donor site probably null
R4602:Tmtc2 UTSW 10 105413530 missense probably benign
R4603:Tmtc2 UTSW 10 105413530 missense probably benign
R4624:Tmtc2 UTSW 10 105303650 missense probably benign 0.04
R4625:Tmtc2 UTSW 10 105303650 missense probably benign 0.04
R4628:Tmtc2 UTSW 10 105303650 missense probably benign 0.04
R4629:Tmtc2 UTSW 10 105303650 missense probably benign 0.04
R5192:Tmtc2 UTSW 10 105190177 missense probably damaging 1.00
R5769:Tmtc2 UTSW 10 105370046 missense probably benign 0.00
R5846:Tmtc2 UTSW 10 105271441 intron probably benign
R5897:Tmtc2 UTSW 10 105413598 missense probably damaging 1.00
R6362:Tmtc2 UTSW 10 105369970 missense probably damaging 1.00
R6391:Tmtc2 UTSW 10 105573690 missense probably benign 0.06
R6640:Tmtc2 UTSW 10 105573749 start codon destroyed probably benign 0.01
R6812:Tmtc2 UTSW 10 105413269 missense probably benign 0.01
R6975:Tmtc2 UTSW 10 105323002 missense probably benign 0.01
R7042:Tmtc2 UTSW 10 105370616 missense probably damaging 1.00
R7063:Tmtc2 UTSW 10 105348525 missense probably damaging 1.00
R7211:Tmtc2 UTSW 10 105573726 missense probably benign 0.31
R7288:Tmtc2 UTSW 10 105413608 missense probably damaging 1.00
R7576:Tmtc2 UTSW 10 105370621 missense probably damaging 1.00
R7728:Tmtc2 UTSW 10 105271497 critical splice donor site probably null
R7850:Tmtc2 UTSW 10 105573707 missense probably benign 0.01
R8024:Tmtc2 UTSW 10 105190126 missense probably benign 0.37
R8417:Tmtc2 UTSW 10 105413236 missense probably damaging 0.98
R8697:Tmtc2 UTSW 10 105369970 missense probably damaging 1.00
Z1176:Tmtc2 UTSW 10 105303622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTTTCCAAAGCATGCTGC -3'
(R):5'- CTCTTCTAACCCACAGCGGTAG -3'

Sequencing Primer
(F):5'- GCATCCAGCGCACAATCCAG -3'
(R):5'- GGTAGCCACAAGTCCTACCG -3'
Posted On2017-02-15