Incidental Mutation 'R5892:Vrk2'
ID457252
Institutional Source Beutler Lab
Gene Symbol Vrk2
Ensembl Gene ENSMUSG00000064090
Gene Namevaccinia related kinase 2
Synonyms2810003O05Rik
MMRRC Submission 044093-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R5892 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location26471322-26593999 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 26534372 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078362] [ENSMUST00000109504]
Predicted Effect probably benign
Transcript: ENSMUST00000078362
SMART Domains Protein: ENSMUSP00000077471
Gene: ENSMUSG00000064090

DomainStartEndE-ValueType
Pfam:Pkinase 29 298 4.4e-18 PFAM
Pfam:Pkinase_Tyr 29 313 2e-11 PFAM
low complexity region 365 376 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109504
SMART Domains Protein: ENSMUSP00000105130
Gene: ENSMUSG00000064090

DomainStartEndE-ValueType
Pfam:Pkinase 29 302 2.8e-22 PFAM
Pfam:Pkinase_Tyr 29 313 1.3e-11 PFAM
low complexity region 365 376 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133487
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. The encoded protein acts as an effector of signaling pathways that regulate apoptosis and tumor cell growth. Variants in this gene have been associated with schizophrenia. Alternative splicing results in multiple transcript variants that differ in their subcellular localization and biological activity. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik G T 5: 99,979,265 probably benign Het
Abcb11 C T 2: 69,261,500 A893T probably damaging Het
Adtrp A T 13: 41,828,206 N30K probably benign Het
Alms1 T A 6: 85,620,903 S904T probably damaging Het
Cep170 T A 1: 176,755,387 probably null Het
Cntnap3 A G 13: 64,799,180 V145A probably damaging Het
Dclre1a T C 19: 56,547,140 E4G probably benign Het
Depdc1a G C 3: 159,526,669 A686P probably damaging Het
Dnah7b T C 1: 46,337,593 probably null Het
Enox1 A G 14: 77,486,017 probably benign Het
Fam107b A G 2: 3,778,564 E268G probably damaging Het
Fer1l6 A G 15: 58,564,068 S437G probably benign Het
Flnb C A 14: 7,907,183 T1252K probably damaging Het
Fubp1 A G 3: 152,218,314 probably benign Het
Gm20402 G A 3: 52,268,949 A50T probably benign Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gzmk C T 13: 113,173,922 probably null Het
Ino80 A T 2: 119,439,547 probably benign Het
Ints8 T C 4: 11,223,813 T677A probably damaging Het
Kat6a A G 8: 22,938,289 E1220G probably damaging Het
Lrfn5 A G 12: 61,843,418 T498A probably damaging Het
Lrp2 T A 2: 69,442,776 T4043S probably benign Het
Malrd1 A G 2: 15,614,267 N314S probably benign Het
Mfsd1 A G 3: 67,589,829 probably null Het
Muc1 C T 3: 89,230,993 P381S probably benign Het
Myh2 A T 11: 67,185,176 K730* probably null Het
Nat3 T A 8: 67,547,938 N156K probably benign Het
Nelfe T C 17: 34,854,669 probably benign Het
Nlrp1a A T 11: 71,099,645 L927Q probably damaging Het
P4ha2 A G 11: 54,120,188 Y343C probably damaging Het
Pclo A T 5: 14,521,171 Q190L probably damaging Het
Pde8a A G 7: 81,295,691 N183S probably damaging Het
Plekha2 C T 8: 25,052,365 V278I probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plxnb1 T C 9: 109,111,707 L1550P probably damaging Het
Ppox C T 1: 171,277,461 V385I probably damaging Het
Prdm16 T C 4: 154,323,259 D1170G possibly damaging Het
Prmt5 A T 14: 54,509,911 S470T probably damaging Het
Robo2 T A 16: 73,895,780 probably benign Het
Siglecg G A 7: 43,412,204 probably benign Het
Slc30a5 T C 13: 100,813,302 N367S probably damaging Het
Tex29 C T 8: 11,854,288 probably benign Het
Tmem117 T A 15: 94,638,139 V18E probably damaging Het
Tmtc2 C T 10: 105,413,505 M122I probably benign Het
Tpr T A 1: 150,407,400 N287K probably benign Het
Unc93b1 A T 19: 3,943,632 D358V probably damaging Het
Wdr24 A T 17: 25,827,986 Q671L probably benign Het
Zfp110 C T 7: 12,848,478 T351I probably benign Het
Zfp963 T C 8: 69,743,377 D142G probably benign Het
Other mutations in Vrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01865:Vrk2 APN 11 26535560 missense possibly damaging 0.73
IGL02011:Vrk2 APN 11 26471717 missense probably benign 0.10
IGL02185:Vrk2 APN 11 26535638 nonsense probably null
IGL02257:Vrk2 APN 11 26534266 missense probably damaging 1.00
IGL02424:Vrk2 APN 11 26476564 missense probably benign 0.00
macromacro UTSW 11 26549325 missense probably damaging 1.00
R0127:Vrk2 UTSW 11 26534313 splice site probably benign
R0184:Vrk2 UTSW 11 26550046 missense probably damaging 0.98
R0670:Vrk2 UTSW 11 26486959 critical splice donor site probably null
R0751:Vrk2 UTSW 11 26483331 splice site probably benign
R0766:Vrk2 UTSW 11 26535522 splice site probably benign
R1103:Vrk2 UTSW 11 26549325 missense probably damaging 1.00
R1184:Vrk2 UTSW 11 26483331 splice site probably benign
R1312:Vrk2 UTSW 11 26535522 splice site probably benign
R2041:Vrk2 UTSW 11 26547914 missense probably benign 0.01
R2857:Vrk2 UTSW 11 26483324 missense possibly damaging 0.54
R2859:Vrk2 UTSW 11 26483324 missense possibly damaging 0.54
R3615:Vrk2 UTSW 11 26489866 missense possibly damaging 0.90
R3616:Vrk2 UTSW 11 26489866 missense possibly damaging 0.90
R4163:Vrk2 UTSW 11 26547915 missense probably benign 0.00
R4651:Vrk2 UTSW 11 26489803 missense probably damaging 0.98
R4652:Vrk2 UTSW 11 26489803 missense probably damaging 0.98
R4662:Vrk2 UTSW 11 26471611 missense possibly damaging 0.95
R5262:Vrk2 UTSW 11 26591697 missense possibly damaging 0.94
R5458:Vrk2 UTSW 11 26498919 missense probably damaging 0.99
R5529:Vrk2 UTSW 11 26499036 missense probably damaging 1.00
R5840:Vrk2 UTSW 11 26534314 splice site probably benign
R6054:Vrk2 UTSW 11 26486975 missense probably benign 0.20
R6923:Vrk2 UTSW 11 26489893 missense probably damaging 1.00
R6952:Vrk2 UTSW 11 26535597 missense probably damaging 0.97
R7841:Vrk2 UTSW 11 26471457 missense probably damaging 1.00
R7924:Vrk2 UTSW 11 26471457 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGTTATGAGTCGGCCATC -3'
(R):5'- CAAGGTTTTAGGGCTTTAATGATGC -3'

Sequencing Primer
(F):5'- AAATGTTCATTTTCTCTTTACCCGG -3'
(R):5'- ATAACAGCATTTTGGGCCTCTG -3'
Posted On2017-02-15