Incidental Mutation 'R5892:Lrfn5'
ID457256
Institutional Source Beutler Lab
Gene Symbol Lrfn5
Ensembl Gene ENSMUSG00000035653
Gene Nameleucine rich repeat and fibronectin type III domain containing 5
Synonyms
MMRRC Submission 044093-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R5892 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location61523150-61858342 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61843418 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 498 (T498A)
Ref Sequence ENSEMBL: ENSMUSP00000113123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055815] [ENSMUST00000119481]
Predicted Effect probably damaging
Transcript: ENSMUST00000055815
AA Change: T498A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051546
Gene: ENSMUSG00000035653
AA Change: T498A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 19 55 1.11e1 SMART
LRR 74 97 3.07e-1 SMART
LRR_TYP 98 121 1.2e-3 SMART
LRR_TYP 122 145 8.94e-3 SMART
LRR 146 169 6.58e0 SMART
LRR_TYP 170 193 8.34e-3 SMART
LRR 194 218 2.47e1 SMART
LRRCT 240 285 1.65e-2 SMART
IGc2 299 364 3.53e-13 SMART
low complexity region 393 412 N/A INTRINSIC
Blast:FN3 414 495 2e-48 BLAST
transmembrane domain 528 550 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119481
AA Change: T498A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113123
Gene: ENSMUSG00000035653
AA Change: T498A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 19 55 1.11e1 SMART
LRR 74 97 3.07e-1 SMART
LRR_TYP 98 121 1.2e-3 SMART
LRR_TYP 122 145 8.94e-3 SMART
LRR 146 169 6.58e0 SMART
LRR_TYP 170 193 8.34e-3 SMART
LRR 194 218 2.47e1 SMART
LRRCT 240 285 1.65e-2 SMART
IGc2 299 364 3.53e-13 SMART
low complexity region 393 412 N/A INTRINSIC
Blast:FN3 414 495 2e-48 BLAST
transmembrane domain 528 550 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
Meta Mutation Damage Score 0.1113 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the leucine-rich repeat and fibronectin type III domain-containing family of proteins. A similar protein in mouse, a glycosylated transmembrane protein, is thought to function in presynaptic differentiation. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik G T 5: 99,979,265 probably benign Het
Abcb11 C T 2: 69,261,500 A893T probably damaging Het
Adtrp A T 13: 41,828,206 N30K probably benign Het
Alms1 T A 6: 85,620,903 S904T probably damaging Het
Cep170 T A 1: 176,755,387 probably null Het
Cntnap3 A G 13: 64,799,180 V145A probably damaging Het
Dclre1a T C 19: 56,547,140 E4G probably benign Het
Depdc1a G C 3: 159,526,669 A686P probably damaging Het
Dnah7b T C 1: 46,337,593 probably null Het
Enox1 A G 14: 77,486,017 probably benign Het
Fam107b A G 2: 3,778,564 E268G probably damaging Het
Fer1l6 A G 15: 58,564,068 S437G probably benign Het
Flnb C A 14: 7,907,183 T1252K probably damaging Het
Fubp1 A G 3: 152,218,314 probably benign Het
Gm20402 G A 3: 52,268,949 A50T probably benign Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gzmk C T 13: 113,173,922 probably null Het
Ino80 A T 2: 119,439,547 probably benign Het
Ints8 T C 4: 11,223,813 T677A probably damaging Het
Kat6a A G 8: 22,938,289 E1220G probably damaging Het
Lrp2 T A 2: 69,442,776 T4043S probably benign Het
Malrd1 A G 2: 15,614,267 N314S probably benign Het
Mfsd1 A G 3: 67,589,829 probably null Het
Muc1 C T 3: 89,230,993 P381S probably benign Het
Myh2 A T 11: 67,185,176 K730* probably null Het
Nat3 T A 8: 67,547,938 N156K probably benign Het
Nelfe T C 17: 34,854,669 probably benign Het
Nlrp1a A T 11: 71,099,645 L927Q probably damaging Het
P4ha2 A G 11: 54,120,188 Y343C probably damaging Het
Pclo A T 5: 14,521,171 Q190L probably damaging Het
Pde8a A G 7: 81,295,691 N183S probably damaging Het
Plekha2 C T 8: 25,052,365 V278I probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plxnb1 T C 9: 109,111,707 L1550P probably damaging Het
Ppox C T 1: 171,277,461 V385I probably damaging Het
Prdm16 T C 4: 154,323,259 D1170G possibly damaging Het
Prmt5 A T 14: 54,509,911 S470T probably damaging Het
Robo2 T A 16: 73,895,780 probably benign Het
Siglecg G A 7: 43,412,204 probably benign Het
Slc30a5 T C 13: 100,813,302 N367S probably damaging Het
Tex29 C T 8: 11,854,288 probably benign Het
Tmem117 T A 15: 94,638,139 V18E probably damaging Het
Tmtc2 C T 10: 105,413,505 M122I probably benign Het
Tpr T A 1: 150,407,400 N287K probably benign Het
Unc93b1 A T 19: 3,943,632 D358V probably damaging Het
Vrk2 A T 11: 26,534,372 probably benign Het
Wdr24 A T 17: 25,827,986 Q671L probably benign Het
Zfp110 C T 7: 12,848,478 T351I probably benign Het
Zfp963 T C 8: 69,743,377 D142G probably benign Het
Other mutations in Lrfn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Lrfn5 APN 12 61844126 missense probably benign
IGL02010:Lrfn5 APN 12 61839683 missense probably damaging 0.96
IGL03033:Lrfn5 APN 12 61840047 missense probably damaging 1.00
IGL03094:Lrfn5 APN 12 61839746 missense probably benign 0.00
IGL03207:Lrfn5 APN 12 61843326 missense probably damaging 1.00
falstaffian UTSW 12 61843562 missense probably benign 0.21
PIT4696001:Lrfn5 UTSW 12 61843557 missense probably damaging 1.00
R0402:Lrfn5 UTSW 12 61840017 missense probably benign 0.22
R0738:Lrfn5 UTSW 12 61840592 nonsense probably null
R0744:Lrfn5 UTSW 12 61839668 missense probably damaging 1.00
R0833:Lrfn5 UTSW 12 61839668 missense probably damaging 1.00
R0973:Lrfn5 UTSW 12 61843437 missense probably damaging 1.00
R0973:Lrfn5 UTSW 12 61843437 missense probably damaging 1.00
R0974:Lrfn5 UTSW 12 61843437 missense probably damaging 1.00
R1073:Lrfn5 UTSW 12 61840809 missense probably damaging 1.00
R1332:Lrfn5 UTSW 12 61857528 splice site probably benign
R1500:Lrfn5 UTSW 12 61839741 missense probably damaging 1.00
R2039:Lrfn5 UTSW 12 61840323 missense possibly damaging 0.82
R3834:Lrfn5 UTSW 12 61840030 missense probably damaging 1.00
R4171:Lrfn5 UTSW 12 61843382 missense probably damaging 1.00
R4212:Lrfn5 UTSW 12 61843820 missense probably benign
R4394:Lrfn5 UTSW 12 61843490 missense probably damaging 1.00
R4578:Lrfn5 UTSW 12 61843977 missense probably benign
R4661:Lrfn5 UTSW 12 61839647 missense probably damaging 1.00
R4730:Lrfn5 UTSW 12 61840719 missense probably benign 0.03
R4955:Lrfn5 UTSW 12 61839978 missense probably benign 0.29
R4968:Lrfn5 UTSW 12 61839675 missense probably damaging 1.00
R4970:Lrfn5 UTSW 12 61839675 missense probably damaging 1.00
R5078:Lrfn5 UTSW 12 61843874 missense possibly damaging 0.47
R5165:Lrfn5 UTSW 12 61839624 missense possibly damaging 0.89
R5768:Lrfn5 UTSW 12 61839723 missense probably benign 0.44
R6133:Lrfn5 UTSW 12 61843788 missense probably benign 0.22
R6211:Lrfn5 UTSW 12 61839470 missense probably benign 0.00
R6297:Lrfn5 UTSW 12 61843562 missense probably benign 0.21
R6341:Lrfn5 UTSW 12 61843582 nonsense probably null
R6861:Lrfn5 UTSW 12 61839690 missense probably damaging 1.00
R7179:Lrfn5 UTSW 12 61843982 missense probably benign
R7392:Lrfn5 UTSW 12 61840304 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGACCTAAAGCCATAATGACTTTGC -3'
(R):5'- AAACGTTGCTAACCTTCGTGAC -3'

Sequencing Primer
(F):5'- GCCATAATGACTTTGCGTATATGTG -3'
(R):5'- GTGTTGCCCATTATTGTTACAAACC -3'
Posted On2017-02-15