Incidental Mutation 'R5892:Gpr137b'
ID457257
Institutional Source Beutler Lab
Gene Symbol Gpr137b
Ensembl Gene ENSMUSG00000021306
Gene NameG protein-coupled receptor 137B
SynonymsTm7sf1, 2310041G17Rik, C80741
MMRRC Submission 044093-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5892 (G1)
Quality Score101
Status Validated
Chromosome13
Chromosomal Location13357620-13394014 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13359406 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 355 (Y355C)
Ref Sequence ENSEMBL: ENSMUSP00000021738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021738] [ENSMUST00000220628] [ENSMUST00000222958] [ENSMUST00000223093]
Predicted Effect probably damaging
Transcript: ENSMUST00000021738
AA Change: Y355C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021738
Gene: ENSMUSG00000021306
AA Change: Y355C

DomainStartEndE-ValueType
Blast:G_alpha 19 64 9e-7 BLAST
Blast:G_alpha 80 264 2e-22 BLAST
transmembrane domain 276 298 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220628
Predicted Effect probably benign
Transcript: ENSMUST00000222958
Predicted Effect probably benign
Transcript: ENSMUST00000223093
Meta Mutation Damage Score 0.1203 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik G T 5: 99,979,265 probably benign Het
Abcb11 C T 2: 69,261,500 A893T probably damaging Het
Adtrp A T 13: 41,828,206 N30K probably benign Het
Alms1 T A 6: 85,620,903 S904T probably damaging Het
Cep170 T A 1: 176,755,387 probably null Het
Cntnap3 A G 13: 64,799,180 V145A probably damaging Het
Dclre1a T C 19: 56,547,140 E4G probably benign Het
Depdc1a G C 3: 159,526,669 A686P probably damaging Het
Dnah7b T C 1: 46,337,593 probably null Het
Enox1 A G 14: 77,486,017 probably benign Het
Fam107b A G 2: 3,778,564 E268G probably damaging Het
Fer1l6 A G 15: 58,564,068 S437G probably benign Het
Flnb C A 14: 7,907,183 T1252K probably damaging Het
Fubp1 A G 3: 152,218,314 probably benign Het
Gm20402 G A 3: 52,268,949 A50T probably benign Het
Gzmk C T 13: 113,173,922 probably null Het
Ino80 A T 2: 119,439,547 probably benign Het
Ints8 T C 4: 11,223,813 T677A probably damaging Het
Kat6a A G 8: 22,938,289 E1220G probably damaging Het
Lrfn5 A G 12: 61,843,418 T498A probably damaging Het
Lrp2 T A 2: 69,442,776 T4043S probably benign Het
Malrd1 A G 2: 15,614,267 N314S probably benign Het
Mfsd1 A G 3: 67,589,829 probably null Het
Muc1 C T 3: 89,230,993 P381S probably benign Het
Myh2 A T 11: 67,185,176 K730* probably null Het
Nat3 T A 8: 67,547,938 N156K probably benign Het
Nelfe T C 17: 34,854,669 probably benign Het
Nlrp1a A T 11: 71,099,645 L927Q probably damaging Het
P4ha2 A G 11: 54,120,188 Y343C probably damaging Het
Pclo A T 5: 14,521,171 Q190L probably damaging Het
Pde8a A G 7: 81,295,691 N183S probably damaging Het
Plekha2 C T 8: 25,052,365 V278I probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plxnb1 T C 9: 109,111,707 L1550P probably damaging Het
Ppox C T 1: 171,277,461 V385I probably damaging Het
Prdm16 T C 4: 154,323,259 D1170G possibly damaging Het
Prmt5 A T 14: 54,509,911 S470T probably damaging Het
Robo2 T A 16: 73,895,780 probably benign Het
Siglecg G A 7: 43,412,204 probably benign Het
Slc30a5 T C 13: 100,813,302 N367S probably damaging Het
Tex29 C T 8: 11,854,288 probably benign Het
Tmem117 T A 15: 94,638,139 V18E probably damaging Het
Tmtc2 C T 10: 105,413,505 M122I probably benign Het
Tpr T A 1: 150,407,400 N287K probably benign Het
Unc93b1 A T 19: 3,943,632 D358V probably damaging Het
Vrk2 A T 11: 26,534,372 probably benign Het
Wdr24 A T 17: 25,827,986 Q671L probably benign Het
Zfp110 C T 7: 12,848,478 T351I probably benign Het
Zfp963 T C 8: 69,743,377 D142G probably benign Het
Other mutations in Gpr137b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Gpr137b APN 13 13374415 splice site probably benign
IGL00969:Gpr137b APN 13 13365065 nonsense probably null
R0276:Gpr137b UTSW 13 13367575 splice site probably benign
R1102:Gpr137b UTSW 13 13365031 splice site probably benign
R4012:Gpr137b UTSW 13 13359362 missense probably benign
R4712:Gpr137b UTSW 13 13359389 missense probably benign 0.07
R6269:Gpr137b UTSW 13 13363511 missense probably damaging 1.00
R6841:Gpr137b UTSW 13 13363509 missense probably damaging 1.00
R7165:Gpr137b UTSW 13 13367620 missense probably damaging 1.00
R7772:Gpr137b UTSW 13 13359406 missense probably damaging 1.00
R7996:Gpr137b UTSW 13 13359406 missense probably damaging 1.00
R7997:Gpr137b UTSW 13 13359406 missense probably damaging 1.00
R7998:Gpr137b UTSW 13 13359406 missense probably damaging 1.00
R7999:Gpr137b UTSW 13 13359406 missense probably damaging 1.00
R8049:Gpr137b UTSW 13 13359406 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTGGAGCCATGAGAAAG -3'
(R):5'- TTGAATTCAGGCTGGCAGC -3'

Sequencing Primer
(F):5'- CCTGTGGAGCCATGAGAAAGCTATAG -3'
(R):5'- GCAGTGTGCATAGCAGTTTG -3'
Posted On2017-02-15