Mutagenetix > Incidental Mutations

Incidental Mutation 'R5892:Cntnap3'

457259

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

MMRRC Submission

044093-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.059) question?

Stock #

R5892 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 64799180 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 145 (V145A)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

Predicted Effect

probably damaging
Transcript: ENSMUST00000091554
AA Change: V145A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: V145A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Meta Mutation Damage Score

0.2570

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.6%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930524J08Rik	G	T	5: 99,979,265		probably benign	Het
Abcb11	C	T	2: 69,261,500	A893T	probably damaging	Het
Adtrp	A	T	13: 41,828,206	N30K	probably benign	Het
Alms1	T	A	6: 85,620,903	S904T	probably damaging	Het
Cep170	T	A	1: 176,755,387		probably null	Het
Dclre1a	T	C	19: 56,547,140	E4G	probably benign	Het
Depdc1a	G	C	3: 159,526,669	A686P	probably damaging	Het
Dnah7b	T	C	1: 46,337,593		probably null	Het
Enox1	A	G	14: 77,486,017		probably benign	Het
Fam107b	A	G	2: 3,778,564	E268G	probably damaging	Het
Fer1l6	A	G	15: 58,564,068	S437G	probably benign	Het
Flnb	C	A	14: 7,907,183	T1252K	probably damaging	Het
Fubp1	A	G	3: 152,218,314		probably benign	Het
Gm20402	G	A	3: 52,268,949	A50T	probably benign	Het
Gpr137b	T	C	13: 13,359,406	Y355C	probably damaging	Het
Gzmk	C	T	13: 113,173,922		probably null	Het
Ino80	A	T	2: 119,439,547		probably benign	Het
Ints8	T	C	4: 11,223,813	T677A	probably damaging	Het
Kat6a	A	G	8: 22,938,289	E1220G	probably damaging	Het
Lrfn5	A	G	12: 61,843,418	T498A	probably damaging	Het
Lrp2	T	A	2: 69,442,776	T4043S	probably benign	Het
Malrd1	A	G	2: 15,614,267	N314S	probably benign	Het
Mfsd1	A	G	3: 67,589,829		probably null	Het
Muc1	C	T	3: 89,230,993	P381S	probably benign	Het
Myh2	A	T	11: 67,185,176	K730*	probably null	Het
Nat3	T	A	8: 67,547,938	N156K	probably benign	Het
Nelfe	T	C	17: 34,854,669		probably benign	Het
Nlrp1a	A	T	11: 71,099,645	L927Q	probably damaging	Het
P4ha2	A	G	11: 54,120,188	Y343C	probably damaging	Het
Pclo	A	T	5: 14,521,171	Q190L	probably damaging	Het
Pde8a	A	G	7: 81,295,691	N183S	probably damaging	Het
Plekha2	C	T	8: 25,052,365	V278I	probably benign	Het
Plekha6	G	C	1: 133,272,307	R208P	possibly damaging	Het
Plxnb1	T	C	9: 109,111,707	L1550P	probably damaging	Het
Ppox	C	T	1: 171,277,461	V385I	probably damaging	Het
Prdm16	T	C	4: 154,323,259	D1170G	possibly damaging	Het
Prmt5	A	T	14: 54,509,911	S470T	probably damaging	Het
Robo2	T	A	16: 73,895,780		probably benign	Het
Siglecg	G	A	7: 43,412,204		probably benign	Het
Slc30a5	T	C	13: 100,813,302	N367S	probably damaging	Het
Tex29	C	T	8: 11,854,288		probably benign	Het
Tmem117	T	A	15: 94,638,139	V18E	probably damaging	Het
Tmtc2	C	T	10: 105,413,505	M122I	probably benign	Het
Tpr	T	A	1: 150,407,400	N287K	probably benign	Het
Unc93b1	A	T	19: 3,943,632	D358V	probably damaging	Het
Vrk2	A	T	11: 26,534,372		probably benign	Het
Wdr24	A	T	17: 25,827,986	Q671L	probably benign	Het
Zfp110	C	T	7: 12,848,478	T351I	probably benign	Het
Zfp963	T	C	8: 69,743,377	D142G	probably benign	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R7954:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
Z1176:Cntnap3	UTSW	13	64740872
Z1176:Cntnap3	UTSW	13	64792388
Z1177:Cntnap3	UTSW	13	64781892

Predicted Primers

PCR Primer
(F):5'- TAACTGACGCTGGCTTTTGC -3'
(R):5'- CATTACTGGAGTGGATGTAGCAAATAG -3'

Sequencing Primer
(F):5'- TTGCAGCATCTCATGCAG -3'
(R):5'- GAACACATGCCACCATTG -3'

Posted On

2017-02-15