Mutagenetix > Incidental Mutation

Incidental Mutation 'R5892:Slc30a5'

457260

Institutional Source

Beutler Lab

Gene Symbol

Slc30a5

Ensembl Gene

ENSMUSG00000021629

Gene Name

solute carrier family 30 (zinc transporter), member 5

Synonyms

Zntl1, Znt5, 1810010K08Rik, ZTL1, ZnT-5

MMRRC Submission

044093-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.690) question?

Stock #

R5892 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100802648-100833427 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100813302 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 367 (N367S)

Ref Sequence

ENSEMBL: ENSMUSP00000153587 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067246] [ENSMUST00000225922]

AlphaFold

Q8R4H9

Predicted Effect

probably damaging
Transcript: ENSMUST00000067246
AA Change: N424S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000065764
Gene: ENSMUSG00000021629
AA Change: N424S

Domain	Start	End	E-Value	Type
low complexity region	6	23	N/A	INTRINSIC
transmembrane domain	56	75	N/A	INTRINSIC
transmembrane domain	96	113	N/A	INTRINSIC
transmembrane domain	128	145	N/A	INTRINSIC
transmembrane domain	150	164	N/A	INTRINSIC
transmembrane domain	192	214	N/A	INTRINSIC
transmembrane domain	235	254	N/A	INTRINSIC
transmembrane domain	264	286	N/A	INTRINSIC
transmembrane domain	299	321	N/A	INTRINSIC
transmembrane domain	341	360	N/A	INTRINSIC
Pfam:Cation_efflux	417	645	1.9e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000225086

Predicted Effect

probably damaging
Transcript: ENSMUST00000225922
AA Change: N367S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.8221

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.6%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC30A/ZnT family of zinc transporter proteins. ZnT proteins mediate both cellular zinc efflux and zinc sequestration into membrane-bound organelles. The encoded protein plays a role in the early secretory pathway as a heterodimer with zinc transporter 6, and may also regulate zinc sequestration into secretory granules of pancreatic beta cells. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 19. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice are growth retarded and exhibit skeletal defects including reduced bone density. The majority of mutant male mice die suddenly when they reach reproductive age due to bradyarrhythmia, whereas female mice live a normal term. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930524J08Rik	G	T	5: 99,979,265		probably benign	Het
Abcb11	C	T	2: 69,261,500	A893T	probably damaging	Het
Adtrp	A	T	13: 41,828,206	N30K	probably benign	Het
Alms1	T	A	6: 85,620,903	S904T	probably damaging	Het
Cep170	T	A	1: 176,755,387		probably null	Het
Cntnap3	A	G	13: 64,799,180	V145A	probably damaging	Het
Dclre1a	T	C	19: 56,547,140	E4G	probably benign	Het
Depdc1a	G	C	3: 159,526,669	A686P	probably damaging	Het
Dnah7b	T	C	1: 46,337,593		probably null	Het
Enox1	A	G	14: 77,486,017		probably benign	Het
Fam107b	A	G	2: 3,778,564	E268G	probably damaging	Het
Fer1l6	A	G	15: 58,564,068	S437G	probably benign	Het
Flnb	C	A	14: 7,907,183	T1252K	probably damaging	Het
Fubp1	A	G	3: 152,218,314		probably benign	Het
Gm20402	G	A	3: 52,268,949	A50T	probably benign	Het
Gpr137b	T	C	13: 13,359,406	Y355C		Het
Gzmk	C	T	13: 113,173,922		probably null	Het
Ino80	A	T	2: 119,439,547		probably benign	Het
Ints8	T	C	4: 11,223,813	T677A	probably damaging	Het
Kat6a	A	G	8: 22,938,289	E1220G	probably damaging	Het
Lrfn5	A	G	12: 61,843,418	T498A	probably damaging	Het
Lrp2	T	A	2: 69,442,776	T4043S	probably benign	Het
Malrd1	A	G	2: 15,614,267	N314S	probably benign	Het
Mfsd1	A	G	3: 67,589,829		probably null	Het
Muc1	C	T	3: 89,230,993	P381S	probably benign	Het
Myh2	A	T	11: 67,185,176	K730*	probably null	Het
Nat3	T	A	8: 67,547,938	N156K	probably benign	Het
Nelfe	T	C	17: 34,854,669		probably benign	Het
Nlrp1a	A	T	11: 71,099,645	L927Q	probably damaging	Het
P4ha2	A	G	11: 54,120,188	Y343C	probably damaging	Het
Pclo	A	T	5: 14,521,171	Q190L	probably damaging	Het
Pde8a	A	G	7: 81,295,691	N183S	probably damaging	Het
Plekha2	C	T	8: 25,052,365	V278I	probably benign	Het
Plekha6	G	C	1: 133,272,307	R208P	possibly damaging	Het
Plxnb1	T	C	9: 109,111,707	L1550P	probably damaging	Het
Ppox	C	T	1: 171,277,461	V385I	probably damaging	Het
Prdm16	T	C	4: 154,323,259	D1170G	possibly damaging	Het
Prmt5	A	T	14: 54,509,911	S470T	probably damaging	Het
Robo2	T	A	16: 73,895,780		probably benign	Het
Siglecg	G	A	7: 43,412,204		probably benign	Het
Tex29	C	T	8: 11,854,288		probably benign	Het
Tmem117	T	A	15: 94,638,139	V18E	probably damaging	Het
Tmtc2	C	T	10: 105,413,505	M122I	probably benign	Het
Tpr	T	A	1: 150,407,400	N287K	probably benign	Het
Unc93b1	A	T	19: 3,943,632	D358V	probably damaging	Het
Vrk2	A	T	11: 26,534,372		probably benign	Het
Wdr24	A	T	17: 25,827,986	Q671L	probably benign	Het
Zfp110	C	T	7: 12,848,478	T351I	probably benign	Het
Zfp963	T	C	8: 69,743,377	D142G	probably benign	Het

Other mutations in Slc30a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Slc30a5	APN	13	100806666	missense	probably damaging	1.00
IGL01647:Slc30a5	APN	13	100821145	missense	possibly damaging	0.66
IGL02338:Slc30a5	APN	13	100803433	missense	probably damaging	0.99
IGL02408:Slc30a5	APN	13	100813724	missense	probably damaging	1.00
IGL02582:Slc30a5	APN	13	100812647	critical splice donor site	probably null
IGL02987:Slc30a5	APN	13	100803915	missense	probably damaging	1.00
IGL03025:Slc30a5	APN	13	100813887	missense	probably damaging	0.99
IGL03064:Slc30a5	APN	13	100811310	missense	probably damaging	1.00
IGL03089:Slc30a5	APN	13	100813830	missense	probably benign	0.01
IGL03268:Slc30a5	APN	13	100806703	missense	probably damaging	1.00
R0083:Slc30a5	UTSW	13	100803400	missense	probably damaging	1.00
R0108:Slc30a5	UTSW	13	100803400	missense	probably damaging	1.00
R0108:Slc30a5	UTSW	13	100803400	missense	probably damaging	1.00
R0153:Slc30a5	UTSW	13	100826494	missense	possibly damaging	0.46
R0542:Slc30a5	UTSW	13	100809285	splice site	probably null
R0601:Slc30a5	UTSW	13	100814770	intron	probably benign
R1125:Slc30a5	UTSW	13	100803413	missense	probably damaging	1.00
R1434:Slc30a5	UTSW	13	100803442	missense	probably damaging	0.98
R1673:Slc30a5	UTSW	13	100813383	missense	probably benign	0.13
R1762:Slc30a5	UTSW	13	100813462	missense	probably damaging	1.00
R1974:Slc30a5	UTSW	13	100813953	missense	probably benign	0.06
R2082:Slc30a5	UTSW	13	100806533	critical splice donor site	probably null
R2151:Slc30a5	UTSW	13	100803949	missense	probably damaging	1.00
R2152:Slc30a5	UTSW	13	100803949	missense	probably damaging	1.00
R2153:Slc30a5	UTSW	13	100803949	missense	probably damaging	1.00
R3899:Slc30a5	UTSW	13	100818147	missense	probably benign	0.18
R4009:Slc30a5	UTSW	13	100809233	missense	probably damaging	1.00
R4010:Slc30a5	UTSW	13	100809233	missense	probably damaging	1.00
R4270:Slc30a5	UTSW	13	100829013	missense	probably benign	0.04
R4815:Slc30a5	UTSW	13	100813710	missense	probably damaging	1.00
R5048:Slc30a5	UTSW	13	100806741	missense	probably damaging	1.00
R5450:Slc30a5	UTSW	13	100821172	missense	possibly damaging	0.81
R5638:Slc30a5	UTSW	13	100813872	nonsense	probably null
R5911:Slc30a5	UTSW	13	100809092	missense	probably damaging	1.00
R6453:Slc30a5	UTSW	13	100814689	missense	probably benign	0.00
R6769:Slc30a5	UTSW	13	100813860	missense	probably benign	0.19
R6795:Slc30a5	UTSW	13	100817069	missense	probably damaging	1.00
R7020:Slc30a5	UTSW	13	100824913	splice site	probably null
R7224:Slc30a5	UTSW	13	100809254	missense	probably damaging	0.99
R7305:Slc30a5	UTSW	13	100811424	missense	probably damaging	0.98
R7318:Slc30a5	UTSW	13	100813969	missense	probably benign	0.13
R7411:Slc30a5	UTSW	13	100818180	missense	probably benign	0.15
R7563:Slc30a5	UTSW	13	100803972	missense	probably benign	0.30
R8039:Slc30a5	UTSW	13	100813681	critical splice donor site	probably null
R8061:Slc30a5	UTSW	13	100828911	missense	probably damaging	0.99
R8973:Slc30a5	UTSW	13	100806694	missense	probably damaging	0.99
R9150:Slc30a5	UTSW	13	100803407	nonsense	probably null
R9352:Slc30a5	UTSW	13	100803872	missense	probably benign	0.10
R9359:Slc30a5	UTSW	13	100813462	missense	probably damaging	1.00
R9405:Slc30a5	UTSW	13	100813908	missense	probably benign	0.00
R9407:Slc30a5	UTSW	13	100814706	nonsense	probably null
R9628:Slc30a5	UTSW	13	100824914	critical splice donor site	probably null
X0019:Slc30a5	UTSW	13	100813842	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTATTACGAGGCAGCTCTG -3'
(R):5'- AGAGGACAGAAAGGTACCCTTATTG -3'

Sequencing Primer
(F):5'- AGCTCTGCCTCTTACAAGC -3'
(R):5'- TGGATATTCTCCTGAAGGAACACC -3'

Posted On

2017-02-15