Incidental Mutation 'R5892:Gzmk'
ID457261
Institutional Source Beutler Lab
Gene Symbol Gzmk
Ensembl Gene ENSMUSG00000042385
Gene Namegranzyme K
Synonyms
MMRRC Submission 044093-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5892 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location113171608-113225908 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 113173922 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038212] [ENSMUST00000122399] [ENSMUST00000140324]
Predicted Effect probably null
Transcript: ENSMUST00000038212
SMART Domains Protein: ENSMUSP00000044512
Gene: ENSMUSG00000042385

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Tryp_SPc 25 253 2.12e-87 SMART
Predicted Effect probably null
Transcript: ENSMUST00000122399
SMART Domains Protein: ENSMUSP00000113530
Gene: ENSMUSG00000042385

DomainStartEndE-ValueType
Tryp_SPc 1 214 9.28e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140324
SMART Domains Protein: ENSMUSP00000114250
Gene: ENSMUSG00000042385

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Trypsin 26 69 1.2e-18 PFAM
Meta Mutation Damage Score 0.9491 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of a group of related serine proteases from the cytoplasmic granules of cytotoxic lymphocytes. Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here lacks consensus sequences for N-glycosylation present in other granzymes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik G T 5: 99,979,265 probably benign Het
Abcb11 C T 2: 69,261,500 A893T probably damaging Het
Adtrp A T 13: 41,828,206 N30K probably benign Het
Alms1 T A 6: 85,620,903 S904T probably damaging Het
Cep170 T A 1: 176,755,387 probably null Het
Cntnap3 A G 13: 64,799,180 V145A probably damaging Het
Dclre1a T C 19: 56,547,140 E4G probably benign Het
Depdc1a G C 3: 159,526,669 A686P probably damaging Het
Dnah7b T C 1: 46,337,593 probably null Het
Enox1 A G 14: 77,486,017 probably benign Het
Fam107b A G 2: 3,778,564 E268G probably damaging Het
Fer1l6 A G 15: 58,564,068 S437G probably benign Het
Flnb C A 14: 7,907,183 T1252K probably damaging Het
Fubp1 A G 3: 152,218,314 probably benign Het
Gm20402 G A 3: 52,268,949 A50T probably benign Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Ino80 A T 2: 119,439,547 probably benign Het
Ints8 T C 4: 11,223,813 T677A probably damaging Het
Kat6a A G 8: 22,938,289 E1220G probably damaging Het
Lrfn5 A G 12: 61,843,418 T498A probably damaging Het
Lrp2 T A 2: 69,442,776 T4043S probably benign Het
Malrd1 A G 2: 15,614,267 N314S probably benign Het
Mfsd1 A G 3: 67,589,829 probably null Het
Muc1 C T 3: 89,230,993 P381S probably benign Het
Myh2 A T 11: 67,185,176 K730* probably null Het
Nat3 T A 8: 67,547,938 N156K probably benign Het
Nelfe T C 17: 34,854,669 probably benign Het
Nlrp1a A T 11: 71,099,645 L927Q probably damaging Het
P4ha2 A G 11: 54,120,188 Y343C probably damaging Het
Pclo A T 5: 14,521,171 Q190L probably damaging Het
Pde8a A G 7: 81,295,691 N183S probably damaging Het
Plekha2 C T 8: 25,052,365 V278I probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plxnb1 T C 9: 109,111,707 L1550P probably damaging Het
Ppox C T 1: 171,277,461 V385I probably damaging Het
Prdm16 T C 4: 154,323,259 D1170G possibly damaging Het
Prmt5 A T 14: 54,509,911 S470T probably damaging Het
Robo2 T A 16: 73,895,780 probably benign Het
Siglecg G A 7: 43,412,204 probably benign Het
Slc30a5 T C 13: 100,813,302 N367S probably damaging Het
Tex29 C T 8: 11,854,288 probably benign Het
Tmem117 T A 15: 94,638,139 V18E probably damaging Het
Tmtc2 C T 10: 105,413,505 M122I probably benign Het
Tpr T A 1: 150,407,400 N287K probably benign Het
Unc93b1 A T 19: 3,943,632 D358V probably damaging Het
Vrk2 A T 11: 26,534,372 probably benign Het
Wdr24 A T 17: 25,827,986 Q671L probably benign Het
Zfp110 C T 7: 12,848,478 T351I probably benign Het
Zfp963 T C 8: 69,743,377 D142G probably benign Het
Other mutations in Gzmk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Gzmk APN 13 113173124 missense probably benign 0.09
IGL01702:Gzmk APN 13 113180550 missense probably damaging 1.00
IGL02869:Gzmk APN 13 113172026 missense probably damaging 1.00
R1687:Gzmk UTSW 13 113173928 missense probably benign 0.32
R1813:Gzmk UTSW 13 113172893 missense probably damaging 1.00
R1896:Gzmk UTSW 13 113172893 missense probably damaging 1.00
R2113:Gzmk UTSW 13 113173955 missense probably benign 0.33
R2128:Gzmk UTSW 13 113172014 missense probably damaging 0.99
R2993:Gzmk UTSW 13 113180477 missense probably damaging 1.00
R3936:Gzmk UTSW 13 113173025 missense probably damaging 1.00
R4619:Gzmk UTSW 13 113173123 missense probably damaging 0.99
R4838:Gzmk UTSW 13 113173021 missense probably damaging 1.00
R5131:Gzmk UTSW 13 113173948 missense probably benign
R6582:Gzmk UTSW 13 113180511 missense probably damaging 1.00
R7491:Gzmk UTSW 13 113172001 missense probably benign 0.36
R8027:Gzmk UTSW 13 113171900 nonsense probably null
X0025:Gzmk UTSW 13 113180833 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGCATTTCCTGTGGATCCTTG -3'
(R):5'- TCAGGCCATCACCGTGTTAC -3'

Sequencing Primer
(F):5'- ACCTGTTGCTCTTCTATATAGTGAG -3'
(R):5'- ATCACCGTGTTACCTCCATTTTC -3'
Posted On2017-02-15