Incidental Mutation 'R5892:Robo2'
ID 457267
Institutional Source Beutler Lab
Gene Symbol Robo2
Ensembl Gene ENSMUSG00000052516
Gene Name roundabout guidance receptor 2
Synonyms 2600013A04Rik, 9430089E08Rik, D230004I22Rik
MMRRC Submission 044093-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R5892 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 73688727-74208713 bp(-) (GRCm39)
Type of Mutation utr 3 prime
DNA Base Change (assembly) T to A at 73692668 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000117200] [ENSMUST00000117785] [ENSMUST00000226478]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000117200
SMART Domains Protein: ENSMUSP00000113795
Gene: ENSMUSG00000052516

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 326 398 1.3e-11 SMART
IGc2 430 495 3.73e-12 SMART
FN3 522 604 1.42e-15 SMART
FN3 636 721 3.54e-2 SMART
FN3 736 823 6.15e-11 SMART
transmembrane domain 860 882 N/A INTRINSIC
low complexity region 1040 1065 N/A INTRINSIC
low complexity region 1072 1083 N/A INTRINSIC
low complexity region 1191 1199 N/A INTRINSIC
low complexity region 1210 1234 N/A INTRINSIC
low complexity region 1318 1342 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117785
SMART Domains Protein: ENSMUSP00000112776
Gene: ENSMUSG00000052516

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 326 398 1.3e-11 SMART
IGc2 430 495 3.73e-12 SMART
FN3 522 604 1.42e-15 SMART
FN3 636 721 3.54e-2 SMART
FN3 736 823 6.15e-11 SMART
transmembrane domain 860 882 N/A INTRINSIC
low complexity region 1072 1107 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1233 1241 N/A INTRINSIC
low complexity region 1252 1276 N/A INTRINSIC
low complexity region 1351 1362 N/A INTRINSIC
low complexity region 1451 1475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149114
Predicted Effect probably benign
Transcript: ENSMUST00000226478
Predicted Effect probably benign
Transcript: ENSMUST00000231426
Predicted Effect probably benign
Transcript: ENSMUST00000231889
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ROBO family, part of the immunoglobulin superfamily of proteins that are highly conserved from fly to human. The encoded protein is a transmembrane receptor for the slit homolog 2 protein and functions in axon guidance and cell migration. Mutations in this gene are associated with vesicoureteral reflux, characterized by the backward flow of urine from the bladder into the ureters or the kidney. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutants display postnatal lethality, abnormal ureteric bud development, multiple fused kidneys, multiple ureters, and abnormal commissural axon growth. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(3) Gene trapped(3)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik G T 5: 100,127,124 (GRCm39) probably benign Het
Abcb11 C T 2: 69,091,844 (GRCm39) A893T probably damaging Het
Adtrp A T 13: 41,981,682 (GRCm39) N30K probably benign Het
Alms1 T A 6: 85,597,885 (GRCm39) S904T probably damaging Het
Cep170 T A 1: 176,582,953 (GRCm39) probably null Het
Cntnap3 A G 13: 64,946,994 (GRCm39) V145A probably damaging Het
Dclre1a T C 19: 56,535,572 (GRCm39) E4G probably benign Het
Depdc1a G C 3: 159,232,306 (GRCm39) A686P probably damaging Het
Dnah7b T C 1: 46,376,753 (GRCm39) probably null Het
Enox1 A G 14: 77,723,457 (GRCm39) probably benign Het
Fam107b A G 2: 3,779,601 (GRCm39) E268G probably damaging Het
Fer1l6 A G 15: 58,435,917 (GRCm39) S437G probably benign Het
Flnb C A 14: 7,907,183 (GRCm38) T1252K probably damaging Het
Fubp1 A G 3: 151,923,951 (GRCm39) probably benign Het
Gm20402 G A 3: 52,176,370 (GRCm39) A50T probably benign Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Gzmk C T 13: 113,310,456 (GRCm39) probably null Het
Ino80 A T 2: 119,270,028 (GRCm39) probably benign Het
Ints8 T C 4: 11,223,813 (GRCm39) T677A probably damaging Het
Kat6a A G 8: 23,428,305 (GRCm39) E1220G probably damaging Het
Lrfn5 A G 12: 61,890,204 (GRCm39) T498A probably damaging Het
Lrp2 T A 2: 69,273,120 (GRCm39) T4043S probably benign Het
Malrd1 A G 2: 15,619,078 (GRCm39) N314S probably benign Het
Mfsd1 A G 3: 67,497,162 (GRCm39) probably null Het
Muc1 C T 3: 89,138,300 (GRCm39) P381S probably benign Het
Myh2 A T 11: 67,076,002 (GRCm39) K730* probably null Het
Nat3 T A 8: 68,000,590 (GRCm39) N156K probably benign Het
Nelfe T C 17: 35,073,645 (GRCm39) probably benign Het
Nlrp1a A T 11: 70,990,471 (GRCm39) L927Q probably damaging Het
P4ha2 A G 11: 54,011,014 (GRCm39) Y343C probably damaging Het
Pclo A T 5: 14,571,185 (GRCm39) Q190L probably damaging Het
Pde8a A G 7: 80,945,439 (GRCm39) N183S probably damaging Het
Plekha2 C T 8: 25,542,381 (GRCm39) V278I probably benign Het
Plekha6 G C 1: 133,200,045 (GRCm39) R208P possibly damaging Het
Plxnb1 T C 9: 108,940,775 (GRCm39) L1550P probably damaging Het
Ppox C T 1: 171,105,034 (GRCm39) V385I probably damaging Het
Prdm16 T C 4: 154,407,716 (GRCm39) D1170G possibly damaging Het
Prmt5 A T 14: 54,747,368 (GRCm39) S470T probably damaging Het
Siglecg G A 7: 43,061,628 (GRCm39) probably benign Het
Slc30a5 T C 13: 100,949,810 (GRCm39) N367S probably damaging Het
Tex29 C T 8: 11,904,288 (GRCm39) probably benign Het
Tmem117 T A 15: 94,536,020 (GRCm39) V18E probably damaging Het
Tmtc2 C T 10: 105,249,366 (GRCm39) M122I probably benign Het
Tpr T A 1: 150,283,151 (GRCm39) N287K probably benign Het
Unc93b1 A T 19: 3,993,632 (GRCm39) D358V probably damaging Het
Vrk2 A T 11: 26,484,372 (GRCm39) probably benign Het
Wdr24 A T 17: 26,046,960 (GRCm39) Q671L probably benign Het
Zfp110 C T 7: 12,582,405 (GRCm39) T351I probably benign Het
Zfp963 T C 8: 70,196,027 (GRCm39) D142G probably benign Het
Other mutations in Robo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Robo2 APN 16 73,758,588 (GRCm39) missense probably benign
IGL00849:Robo2 APN 16 73,770,665 (GRCm39) missense possibly damaging 0.80
IGL00908:Robo2 APN 16 73,782,579 (GRCm39) missense probably damaging 0.98
IGL00944:Robo2 APN 16 73,730,585 (GRCm39) missense possibly damaging 0.92
IGL00955:Robo2 APN 16 73,812,860 (GRCm39) missense probably damaging 1.00
IGL00970:Robo2 APN 16 73,693,934 (GRCm39) missense probably benign 0.00
IGL01020:Robo2 APN 16 73,725,039 (GRCm39) missense probably benign 0.06
IGL01347:Robo2 APN 16 74,149,744 (GRCm39) missense probably damaging 1.00
IGL02280:Robo2 APN 16 73,843,704 (GRCm39) missense probably damaging 1.00
IGL02424:Robo2 APN 16 73,770,189 (GRCm39) missense possibly damaging 0.89
IGL03376:Robo2 APN 16 73,753,380 (GRCm39) missense probably damaging 1.00
LCD18:Robo2 UTSW 16 74,055,954 (GRCm38) intron probably benign
P0018:Robo2 UTSW 16 73,843,694 (GRCm39) missense possibly damaging 0.82
R0314:Robo2 UTSW 16 73,753,525 (GRCm39) missense probably damaging 1.00
R0324:Robo2 UTSW 16 73,764,739 (GRCm39) missense probably damaging 1.00
R0539:Robo2 UTSW 16 73,782,462 (GRCm39) splice site probably benign
R0620:Robo2 UTSW 16 73,764,690 (GRCm39) missense possibly damaging 0.92
R0630:Robo2 UTSW 16 73,713,093 (GRCm39) missense probably benign 0.05
R0701:Robo2 UTSW 16 73,843,762 (GRCm39) missense probably damaging 1.00
R1155:Robo2 UTSW 16 73,831,996 (GRCm39) missense probably damaging 1.00
R1168:Robo2 UTSW 16 73,745,184 (GRCm39) missense probably damaging 1.00
R1195:Robo2 UTSW 16 73,713,016 (GRCm39) splice site probably null
R1195:Robo2 UTSW 16 73,713,016 (GRCm39) splice site probably null
R1195:Robo2 UTSW 16 73,713,016 (GRCm39) splice site probably null
R1317:Robo2 UTSW 16 73,831,912 (GRCm39) missense probably damaging 1.00
R1422:Robo2 UTSW 16 73,775,336 (GRCm39) missense probably damaging 0.99
R1452:Robo2 UTSW 16 73,758,798 (GRCm39) missense probably damaging 1.00
R1649:Robo2 UTSW 16 73,695,889 (GRCm39) missense probably benign 0.36
R1709:Robo2 UTSW 16 73,753,411 (GRCm39) missense possibly damaging 0.83
R1751:Robo2 UTSW 16 73,831,912 (GRCm39) missense probably damaging 1.00
R1761:Robo2 UTSW 16 73,831,912 (GRCm39) missense probably damaging 1.00
R1885:Robo2 UTSW 16 73,713,033 (GRCm39) missense probably benign 0.00
R1911:Robo2 UTSW 16 73,755,213 (GRCm39) missense probably damaging 1.00
R1919:Robo2 UTSW 16 73,696,042 (GRCm39) missense probably benign
R2005:Robo2 UTSW 16 73,730,003 (GRCm39) missense possibly damaging 0.82
R2851:Robo2 UTSW 16 73,758,776 (GRCm39) missense probably damaging 1.00
R3732:Robo2 UTSW 16 73,717,635 (GRCm39) missense possibly damaging 0.64
R3732:Robo2 UTSW 16 73,717,635 (GRCm39) missense possibly damaging 0.64
R3733:Robo2 UTSW 16 73,717,635 (GRCm39) missense possibly damaging 0.64
R3734:Robo2 UTSW 16 73,717,635 (GRCm39) missense possibly damaging 0.64
R3913:Robo2 UTSW 16 73,831,893 (GRCm39) missense probably damaging 1.00
R3956:Robo2 UTSW 16 73,758,755 (GRCm39) missense probably damaging 1.00
R4394:Robo2 UTSW 16 73,745,267 (GRCm39) missense probably benign 0.13
R4426:Robo2 UTSW 16 73,745,154 (GRCm39) missense probably damaging 1.00
R4437:Robo2 UTSW 16 73,770,132 (GRCm39) missense possibly damaging 0.88
R4454:Robo2 UTSW 16 74,149,407 (GRCm39) intron probably benign
R4478:Robo2 UTSW 16 73,812,761 (GRCm39) missense probably damaging 1.00
R4586:Robo2 UTSW 16 73,758,761 (GRCm39) missense probably damaging 0.96
R4621:Robo2 UTSW 16 73,782,821 (GRCm39) missense probably benign 0.00
R4673:Robo2 UTSW 16 73,701,266 (GRCm39) splice site probably null
R4798:Robo2 UTSW 16 74,149,633 (GRCm39) missense probably damaging 1.00
R4812:Robo2 UTSW 16 73,713,176 (GRCm39) missense probably benign 0.00
R4855:Robo2 UTSW 16 73,768,079 (GRCm39) missense probably damaging 1.00
R4910:Robo2 UTSW 16 73,730,666 (GRCm39) missense probably damaging 0.99
R4916:Robo2 UTSW 16 73,695,803 (GRCm39) missense possibly damaging 0.53
R4948:Robo2 UTSW 16 74,149,726 (GRCm39) missense possibly damaging 0.88
R5325:Robo2 UTSW 16 73,770,673 (GRCm39) missense possibly damaging 0.72
R5326:Robo2 UTSW 16 73,695,853 (GRCm39) missense probably benign 0.20
R5447:Robo2 UTSW 16 73,770,654 (GRCm39) nonsense probably null
R5542:Robo2 UTSW 16 73,695,853 (GRCm39) missense probably benign 0.20
R5545:Robo2 UTSW 16 73,758,635 (GRCm39) missense probably damaging 1.00
R5646:Robo2 UTSW 16 73,758,707 (GRCm39) missense probably damaging 0.99
R5734:Robo2 UTSW 16 74,149,672 (GRCm39) missense probably damaging 1.00
R5960:Robo2 UTSW 16 73,730,603 (GRCm39) missense probably damaging 1.00
R6126:Robo2 UTSW 16 73,717,570 (GRCm39) missense probably benign 0.00
R6130:Robo2 UTSW 16 73,717,570 (GRCm39) missense probably benign 0.00
R6153:Robo2 UTSW 16 73,717,617 (GRCm39) missense probably damaging 1.00
R6240:Robo2 UTSW 16 73,779,027 (GRCm39) missense probably damaging 1.00
R6247:Robo2 UTSW 16 73,764,672 (GRCm39) missense probably damaging 1.00
R6304:Robo2 UTSW 16 73,755,196 (GRCm39) missense probably damaging 1.00
R6337:Robo2 UTSW 16 73,725,039 (GRCm39) missense probably benign 0.06
R6431:Robo2 UTSW 16 73,843,697 (GRCm39) nonsense probably null
R6440:Robo2 UTSW 16 73,713,010 (GRCm39) missense probably benign 0.31
R6596:Robo2 UTSW 16 73,767,996 (GRCm39) missense probably damaging 1.00
R6919:Robo2 UTSW 16 73,758,755 (GRCm39) missense probably damaging 1.00
R6927:Robo2 UTSW 16 73,778,946 (GRCm39) missense probably damaging 1.00
R7029:Robo2 UTSW 16 73,745,225 (GRCm39) missense probably damaging 1.00
R7078:Robo2 UTSW 16 74,149,504 (GRCm39) missense probably damaging 1.00
R7092:Robo2 UTSW 16 73,753,531 (GRCm39) missense probably damaging 0.99
R7136:Robo2 UTSW 16 73,753,438 (GRCm39) missense probably damaging 0.99
R7192:Robo2 UTSW 16 73,717,638 (GRCm39) missense probably benign 0.19
R7569:Robo2 UTSW 16 73,832,003 (GRCm39) missense possibly damaging 0.82
R7686:Robo2 UTSW 16 73,755,293 (GRCm39) missense probably damaging 1.00
R7720:Robo2 UTSW 16 73,693,903 (GRCm39) missense probably benign 0.00
R7772:Robo2 UTSW 16 73,758,777 (GRCm39) missense probably benign 0.24
R7822:Robo2 UTSW 16 73,770,059 (GRCm39) missense probably damaging 1.00
R7849:Robo2 UTSW 16 73,770,132 (GRCm39) missense possibly damaging 0.88
R7881:Robo2 UTSW 16 73,717,585 (GRCm39) missense probably benign 0.00
R7897:Robo2 UTSW 16 73,695,838 (GRCm39) missense probably benign
R8135:Robo2 UTSW 16 73,730,048 (GRCm39) missense probably benign 0.04
R8297:Robo2 UTSW 16 73,812,814 (GRCm39) nonsense probably null
R8307:Robo2 UTSW 16 73,753,498 (GRCm39) missense probably damaging 1.00
R8379:Robo2 UTSW 16 73,730,588 (GRCm39) missense probably damaging 0.99
R8393:Robo2 UTSW 16 73,775,382 (GRCm39) missense probably damaging 1.00
R8474:Robo2 UTSW 16 73,745,150 (GRCm39) missense probably damaging 1.00
R8500:Robo2 UTSW 16 73,745,228 (GRCm39) missense probably damaging 1.00
R8721:Robo2 UTSW 16 73,703,798 (GRCm39) missense
R8734:Robo2 UTSW 16 73,764,651 (GRCm39) splice site probably benign
R8735:Robo2 UTSW 16 73,755,247 (GRCm39) missense probably damaging 1.00
R8840:Robo2 UTSW 16 73,782,570 (GRCm39) missense probably damaging 1.00
R8937:Robo2 UTSW 16 73,770,150 (GRCm39) missense probably damaging 1.00
R8937:Robo2 UTSW 16 73,770,149 (GRCm39) missense probably damaging 1.00
R8968:Robo2 UTSW 16 73,767,941 (GRCm39) critical splice donor site probably null
R9134:Robo2 UTSW 16 73,703,738 (GRCm39) missense
R9622:Robo2 UTSW 16 73,729,952 (GRCm39) missense probably benign 0.02
R9662:Robo2 UTSW 16 73,758,566 (GRCm39) critical splice donor site probably null
R9708:Robo2 UTSW 16 73,770,197 (GRCm39) missense possibly damaging 0.70
R9779:Robo2 UTSW 16 73,767,965 (GRCm39) missense probably damaging 0.97
X0063:Robo2 UTSW 16 73,842,716 (GRCm39) missense probably damaging 1.00
Z1176:Robo2 UTSW 16 73,730,479 (GRCm39) missense probably benign 0.35
Z1177:Robo2 UTSW 16 73,737,187 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTCCTGACAAGAAAGAGTTAAGGTG -3'
(R):5'- ATCCTATGTCTGCGAGCTCC -3'

Sequencing Primer
(F):5'- TTAAGGTGGGTGGTGTAAGTAAGAG -3'
(R):5'- ATGTCTGCGAGCTCCCTGATAC -3'
Posted On 2017-02-15