Incidental Mutation 'R5892:Wdr24'
ID457269
Institutional Source Beutler Lab
Gene Symbol Wdr24
Ensembl Gene ENSMUSG00000025737
Gene NameWD repeat domain 24
Synonyms
MMRRC Submission 044093-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5892 (G1)
Quality Score213
Status Validated
Chromosome17
Chromosomal Location25823627-25828730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25827986 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 671 (Q671L)
Ref Sequence ENSEMBL: ENSMUSP00000026833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026832] [ENSMUST00000026833] [ENSMUST00000044911] [ENSMUST00000123582] [ENSMUST00000133595]
Predicted Effect probably benign
Transcript: ENSMUST00000026832
SMART Domains Protein: ENSMUSP00000026832
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
JmjC 140 271 5.27e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026833
AA Change: Q671L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026833
Gene: ENSMUSG00000025737
AA Change: Q671L

DomainStartEndE-ValueType
Blast:WD40 19 53 6e-8 BLAST
WD40 68 103 2.13e1 SMART
WD40 109 149 5.77e-5 SMART
WD40 152 192 4.48e-2 SMART
WD40 196 236 1.48e-11 SMART
WD40 244 282 1.66e0 SMART
WD40 286 327 2.48e0 SMART
low complexity region 605 623 N/A INTRINSIC
Blast:RING 743 780 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000044911
SMART Domains Protein: ENSMUSP00000040431
Gene: ENSMUSG00000039615

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
TPR 27 60 2.43e1 SMART
TPR 61 94 1.48e-7 SMART
TPR 95 128 4.52e-3 SMART
low complexity region 168 180 N/A INTRINSIC
Ubox 231 294 1.27e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123560
Predicted Effect probably benign
Transcript: ENSMUST00000123582
SMART Domains Protein: ENSMUSP00000119840
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
low complexity region 158 172 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123692
Predicted Effect probably benign
Transcript: ENSMUST00000133595
SMART Domains Protein: ENSMUSP00000122744
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
transmembrane domain 55 74 N/A INTRINSIC
JmjC 185 316 5.27e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144589
Predicted Effect probably benign
Transcript: ENSMUST00000152434
SMART Domains Protein: ENSMUSP00000119378
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Meta Mutation Damage Score 0.0854 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik G T 5: 99,979,265 probably benign Het
Abcb11 C T 2: 69,261,500 A893T probably damaging Het
Adtrp A T 13: 41,828,206 N30K probably benign Het
Alms1 T A 6: 85,620,903 S904T probably damaging Het
Cep170 T A 1: 176,755,387 probably null Het
Cntnap3 A G 13: 64,799,180 V145A probably damaging Het
Dclre1a T C 19: 56,547,140 E4G probably benign Het
Depdc1a G C 3: 159,526,669 A686P probably damaging Het
Dnah7b T C 1: 46,337,593 probably null Het
Enox1 A G 14: 77,486,017 probably benign Het
Fam107b A G 2: 3,778,564 E268G probably damaging Het
Fer1l6 A G 15: 58,564,068 S437G probably benign Het
Flnb C A 14: 7,907,183 T1252K probably damaging Het
Fubp1 A G 3: 152,218,314 probably benign Het
Gm20402 G A 3: 52,268,949 A50T probably benign Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gzmk C T 13: 113,173,922 probably null Het
Ino80 A T 2: 119,439,547 probably benign Het
Ints8 T C 4: 11,223,813 T677A probably damaging Het
Kat6a A G 8: 22,938,289 E1220G probably damaging Het
Lrfn5 A G 12: 61,843,418 T498A probably damaging Het
Lrp2 T A 2: 69,442,776 T4043S probably benign Het
Malrd1 A G 2: 15,614,267 N314S probably benign Het
Mfsd1 A G 3: 67,589,829 probably null Het
Muc1 C T 3: 89,230,993 P381S probably benign Het
Myh2 A T 11: 67,185,176 K730* probably null Het
Nat3 T A 8: 67,547,938 N156K probably benign Het
Nelfe T C 17: 34,854,669 probably benign Het
Nlrp1a A T 11: 71,099,645 L927Q probably damaging Het
P4ha2 A G 11: 54,120,188 Y343C probably damaging Het
Pclo A T 5: 14,521,171 Q190L probably damaging Het
Pde8a A G 7: 81,295,691 N183S probably damaging Het
Plekha2 C T 8: 25,052,365 V278I probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plxnb1 T C 9: 109,111,707 L1550P probably damaging Het
Ppox C T 1: 171,277,461 V385I probably damaging Het
Prdm16 T C 4: 154,323,259 D1170G possibly damaging Het
Prmt5 A T 14: 54,509,911 S470T probably damaging Het
Robo2 T A 16: 73,895,780 probably benign Het
Siglecg G A 7: 43,412,204 probably benign Het
Slc30a5 T C 13: 100,813,302 N367S probably damaging Het
Tex29 C T 8: 11,854,288 probably benign Het
Tmem117 T A 15: 94,638,139 V18E probably damaging Het
Tmtc2 C T 10: 105,413,505 M122I probably benign Het
Tpr T A 1: 150,407,400 N287K probably benign Het
Unc93b1 A T 19: 3,943,632 D358V probably damaging Het
Vrk2 A T 11: 26,534,372 probably benign Het
Zfp110 C T 7: 12,848,478 T351I probably benign Het
Zfp963 T C 8: 69,743,377 D142G probably benign Het
Other mutations in Wdr24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Wdr24 APN 17 25826621 missense probably benign 0.20
IGL01700:Wdr24 APN 17 25825828 missense probably damaging 1.00
IGL01763:Wdr24 APN 17 25826190 missense probably benign 0.20
IGL02567:Wdr24 APN 17 25824348 missense probably damaging 0.99
IGL03100:Wdr24 APN 17 25825707 missense possibly damaging 0.47
R0012:Wdr24 UTSW 17 25827113 missense probably benign
R0799:Wdr24 UTSW 17 25826128 missense probably damaging 1.00
R1015:Wdr24 UTSW 17 25828238 missense probably benign 0.12
R1276:Wdr24 UTSW 17 25827467 missense probably benign 0.02
R1297:Wdr24 UTSW 17 25827348 missense possibly damaging 0.90
R1934:Wdr24 UTSW 17 25824266 missense possibly damaging 0.89
R2030:Wdr24 UTSW 17 25826043 missense probably benign 0.38
R2069:Wdr24 UTSW 17 25826282 missense probably damaging 1.00
R2508:Wdr24 UTSW 17 25824299 missense possibly damaging 0.52
R4601:Wdr24 UTSW 17 25828207 unclassified probably null
R4604:Wdr24 UTSW 17 25828505 missense probably damaging 1.00
R4894:Wdr24 UTSW 17 25826127 missense probably damaging 1.00
R5068:Wdr24 UTSW 17 25825779 missense possibly damaging 0.77
R5088:Wdr24 UTSW 17 25828207 unclassified probably null
R5104:Wdr24 UTSW 17 25824591 missense probably damaging 1.00
R5498:Wdr24 UTSW 17 25824561 missense probably damaging 1.00
R5719:Wdr24 UTSW 17 25828340 critical splice donor site probably null
R5975:Wdr24 UTSW 17 25827128 missense probably benign 0.37
R6084:Wdr24 UTSW 17 25824530 missense probably damaging 0.99
R6106:Wdr24 UTSW 17 25824605 missense probably benign
R6114:Wdr24 UTSW 17 25824605 missense probably benign
R6116:Wdr24 UTSW 17 25824605 missense probably benign
R6165:Wdr24 UTSW 17 25826421 missense probably benign 0.18
R6175:Wdr24 UTSW 17 25826578 missense probably damaging 1.00
R6331:Wdr24 UTSW 17 25825676 missense possibly damaging 0.61
R6548:Wdr24 UTSW 17 25827925 missense probably damaging 0.99
R6984:Wdr24 UTSW 17 25828235 missense possibly damaging 0.93
R7485:Wdr24 UTSW 17 25826127 missense probably damaging 1.00
R7583:Wdr24 UTSW 17 25825830 missense probably null 1.00
R7770:Wdr24 UTSW 17 25827096 missense probably benign 0.04
X0022:Wdr24 UTSW 17 25824272 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGGCAGACACAGCTTCATTAG -3'
(R):5'- GTAGGATGTGTACCAGTGCTCC -3'

Sequencing Primer
(F):5'- TTCATTAGCCCCGGTGGAC -3'
(R):5'- TCAGATGAGGGAACCAGC -3'
Posted On2017-02-15