Incidental Mutation 'R5892:Unc93b1'
ID457271
Institutional Source Beutler Lab
Gene Symbol Unc93b1
Ensembl Gene ENSMUSG00000036908
Gene Nameunc-93 homolog B1 (C. elegans)
Synonymsunc-93 homolog B, unc-93 related protein
MMRRC Submission 044093-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5892 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location3935186-3949340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3943632 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 358 (D358V)
Ref Sequence ENSEMBL: ENSMUSP00000128751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162708] [ENSMUST00000165711]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161415
Predicted Effect probably damaging
Transcript: ENSMUST00000162708
AA Change: D358V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124272
Gene: ENSMUSG00000036908
AA Change: D358V

DomainStartEndE-ValueType
low complexity region 66 78 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
Pfam:UNC-93 135 214 1.6e-8 PFAM
transmembrane domain 238 260 N/A INTRINSIC
transmembrane domain 306 328 N/A INTRINSIC
transmembrane domain 364 386 N/A INTRINSIC
transmembrane domain 396 418 N/A INTRINSIC
transmembrane domain 423 445 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
transmembrane domain 494 513 N/A INTRINSIC
transmembrane domain 518 535 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165711
AA Change: D358V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128751
Gene: ENSMUSG00000036908
AA Change: D358V

DomainStartEndE-ValueType
low complexity region 66 78 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
Pfam:UNC-93 135 214 5.1e-9 PFAM
transmembrane domain 243 265 N/A INTRINSIC
transmembrane domain 305 327 N/A INTRINSIC
transmembrane domain 367 389 N/A INTRINSIC
Meta Mutation Damage Score 0.8004 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in innate and adaptive immune response by regulating toll-like receptor signaling. The encoded protein traffics nucleotide sensing toll-like receptors to the endolysosome from the endoplasmic reticulum. Deficiency of the encoded protein has been associated with herpes simplex encephalitis. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice with a transmembrane domain point mutation have no overt phenotype but fail to mount a normal cytokine response and exhibit increased susceptibility to mouse cytomegalovirus, Lysteria monocytogenes and Staphlococcus aureus. Antigen presentation by MHC class I and II is impaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik G T 5: 99,979,265 probably benign Het
Abcb11 C T 2: 69,261,500 A893T probably damaging Het
Adtrp A T 13: 41,828,206 N30K probably benign Het
Alms1 T A 6: 85,620,903 S904T probably damaging Het
Cep170 T A 1: 176,755,387 probably null Het
Cntnap3 A G 13: 64,799,180 V145A probably damaging Het
Dclre1a T C 19: 56,547,140 E4G probably benign Het
Depdc1a G C 3: 159,526,669 A686P probably damaging Het
Dnah7b T C 1: 46,337,593 probably null Het
Enox1 A G 14: 77,486,017 probably benign Het
Fam107b A G 2: 3,778,564 E268G probably damaging Het
Fer1l6 A G 15: 58,564,068 S437G probably benign Het
Flnb C A 14: 7,907,183 T1252K probably damaging Het
Fubp1 A G 3: 152,218,314 probably benign Het
Gm20402 G A 3: 52,268,949 A50T probably benign Het
Gpr137b T C 13: 13,359,406 Y355C Het
Gzmk C T 13: 113,173,922 probably null Het
Ino80 A T 2: 119,439,547 probably benign Het
Ints8 T C 4: 11,223,813 T677A probably damaging Het
Kat6a A G 8: 22,938,289 E1220G probably damaging Het
Lrfn5 A G 12: 61,843,418 T498A probably damaging Het
Lrp2 T A 2: 69,442,776 T4043S probably benign Het
Malrd1 A G 2: 15,614,267 N314S probably benign Het
Mfsd1 A G 3: 67,589,829 probably null Het
Muc1 C T 3: 89,230,993 P381S probably benign Het
Myh2 A T 11: 67,185,176 K730* probably null Het
Nat3 T A 8: 67,547,938 N156K probably benign Het
Nelfe T C 17: 34,854,669 probably benign Het
Nlrp1a A T 11: 71,099,645 L927Q probably damaging Het
P4ha2 A G 11: 54,120,188 Y343C probably damaging Het
Pclo A T 5: 14,521,171 Q190L probably damaging Het
Pde8a A G 7: 81,295,691 N183S probably damaging Het
Plekha2 C T 8: 25,052,365 V278I probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plxnb1 T C 9: 109,111,707 L1550P probably damaging Het
Ppox C T 1: 171,277,461 V385I probably damaging Het
Prdm16 T C 4: 154,323,259 D1170G possibly damaging Het
Prmt5 A T 14: 54,509,911 S470T probably damaging Het
Robo2 T A 16: 73,895,780 probably benign Het
Siglecg G A 7: 43,412,204 probably benign Het
Slc30a5 T C 13: 100,813,302 N367S probably damaging Het
Tex29 C T 8: 11,854,288 probably benign Het
Tmem117 T A 15: 94,638,139 V18E probably damaging Het
Tmtc2 C T 10: 105,413,505 M122I probably benign Het
Tpr T A 1: 150,407,400 N287K probably benign Het
Vrk2 A T 11: 26,534,372 probably benign Het
Wdr24 A T 17: 25,827,986 Q671L probably benign Het
Zfp110 C T 7: 12,848,478 T351I probably benign Het
Zfp963 T C 8: 69,743,377 D142G probably benign Het
Other mutations in Unc93b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Unc93b1 APN 19 3935356 splice site probably null
IGL02631:Unc93b1 APN 19 3942026 splice site probably benign
IGL02942:Unc93b1 APN 19 3948686 missense probably damaging 1.00
IGL03149:Unc93b1 APN 19 3944041 missense probably benign
3d UTSW 19 3944168 missense possibly damaging 0.96
novelty UTSW 19 3943632 missense probably damaging 1.00
speciality UTSW 19 3941910 missense possibly damaging 0.51
R0680:Unc93b1 UTSW 19 3947093 missense probably benign
R1237:Unc93b1 UTSW 19 3935228 missense possibly damaging 0.72
R1557:Unc93b1 UTSW 19 3942403 missense probably benign 0.13
R1992:Unc93b1 UTSW 19 3944062 missense probably benign 0.00
R2435:Unc93b1 UTSW 19 3936373 missense possibly damaging 0.89
R4016:Unc93b1 UTSW 19 3943572 missense probably damaging 1.00
R4080:Unc93b1 UTSW 19 3941959 missense probably damaging 0.99
R4479:Unc93b1 UTSW 19 3935236 missense probably benign 0.16
R4829:Unc93b1 UTSW 19 3944293 missense probably damaging 1.00
R4947:Unc93b1 UTSW 19 3935871 missense probably benign 0.05
R4964:Unc93b1 UTSW 19 3942023 splice site probably null
R4966:Unc93b1 UTSW 19 3942023 splice site probably null
R5056:Unc93b1 UTSW 19 3942762 missense possibly damaging 0.45
R5166:Unc93b1 UTSW 19 3944027 missense probably damaging 1.00
R5441:Unc93b1 UTSW 19 3943703 missense probably benign 0.01
R6382:Unc93b1 UTSW 19 3935297 missense probably benign 0.19
R6556:Unc93b1 UTSW 19 3944105 missense probably benign
R6962:Unc93b1 UTSW 19 3936303 missense possibly damaging 0.57
R7143:Unc93b1 UTSW 19 3935204 missense unknown
R7748:Unc93b1 UTSW 19 3935250 missense unknown
R7866:Unc93b1 UTSW 19 3935243 missense not run
R8198:Unc93b1 UTSW 19 3941910 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- TCCTGAGTAGAAGTGTGGGC -3'
(R):5'- CCCTCTAAGGCTGGTAGAAAGG -3'

Sequencing Primer
(F):5'- GCGGAGTCTCGAGCTGAG -3'
(R):5'- AGGGTGAAAGCATCTCCATTC -3'
Posted On2017-02-15