Incidental Mutation 'R5893:Uggt1'
ID457273
Institutional Source Beutler Lab
Gene Symbol Uggt1
Ensembl Gene ENSMUSG00000037470
Gene NameUDP-glucose glycoprotein glucosyltransferase 1
SynonymsUgcgl1, C820010P03Rik, A930007H10Rik, 0910001L17Rik
MMRRC Submission 044094-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.731) question?
Stock #R5893 (G1)
Quality Score216
Status Validated
Chromosome1
Chromosomal Location36140027-36244720 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 36227628 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046875] [ENSMUST00000046875] [ENSMUST00000174266] [ENSMUST00000174266]
Predicted Effect probably null
Transcript: ENSMUST00000046875
SMART Domains Protein: ENSMUSP00000037930
Gene: ENSMUSG00000037470

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:UDP-g_GGTase 44 1222 N/A PFAM
SCOP:d1ga8a_ 1256 1521 3e-45 SMART
Blast:BROMO 1414 1453 3e-17 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000046875
SMART Domains Protein: ENSMUSP00000037930
Gene: ENSMUSG00000037470

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:UDP-g_GGTase 44 1222 N/A PFAM
SCOP:d1ga8a_ 1256 1521 3e-45 SMART
Blast:BROMO 1414 1453 3e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174266
SMART Domains Protein: ENSMUSP00000134640
Gene: ENSMUSG00000037470

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
low complexity region 88 97 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174266
SMART Domains Protein: ENSMUSP00000134640
Gene: ENSMUSG00000037470

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
low complexity region 88 97 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174716
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
PHENOTYPE: Heterozygous KO reduces susceptibility to and morbidity of RNA virus infection. Homozygous KO is embryonic lethal. The peptide is a folding sensor for glycoproteins in the ER. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T A 19: 57,215,853 R35S probably benign Het
Acacb A T 5: 114,229,851 I1637F probably benign Het
Adamts18 A T 8: 113,773,077 C402S probably damaging Het
Adra2b T A 2: 127,364,482 D306E probably benign Het
Ammecr1l C T 18: 31,778,920 T263I probably damaging Het
Antxr1 T C 6: 87,137,259 I509V probably benign Het
Bahcc1 A G 11: 120,285,430 E1967G probably damaging Het
Brap T A 5: 121,679,342 Y337* probably null Het
Brca2 T C 5: 150,569,138 V3206A probably benign Het
C330027C09Rik A G 16: 48,997,500 S78G probably benign Het
Cacna1e A T 1: 154,437,323 F1486I probably damaging Het
Cbx4 A G 11: 119,082,190 Y120H probably damaging Het
Ccar2 T A 14: 70,151,351 Q137L probably benign Het
Ceacam12 A G 7: 18,069,374 D235G probably damaging Het
Celsr1 A G 15: 85,904,014 V2679A probably benign Het
Champ1 C T 8: 13,878,777 P312S probably benign Het
Chst5 A G 8: 111,890,196 L264S probably damaging Het
Colec10 T A 15: 54,410,789 F4L probably benign Het
Cyp2a4 G A 7: 26,308,928 G165D probably damaging Het
Cyp2c29 G C 19: 39,330,389 A438P possibly damaging Het
Dlat A G 9: 50,644,139 probably benign Het
Dmxl2 A G 9: 54,387,420 V2457A possibly damaging Het
Dnah7a A G 1: 53,457,785 M3104T possibly damaging Het
Dock8 C T 19: 25,122,447 H645Y probably damaging Het
Ehbp1l1 T C 19: 5,718,431 E948G probably benign Het
Eps8l2 C T 7: 141,357,624 R384C probably damaging Het
Fam174a A T 1: 95,325,159 N162I probably damaging Het
Fbp2 T A 13: 62,837,102 N335I probably benign Het
Foxred2 C A 15: 77,947,144 G490C probably damaging Het
Fyttd1 T G 16: 32,898,913 D200E probably damaging Het
Gdf15 A T 8: 70,629,823 V211E possibly damaging Het
Gm13084 T A 4: 143,810,468 Y431F probably damaging Het
Gm13178 C T 4: 144,703,196 V408I probably benign Het
Gm5065 A T 7: 5,359,624 T85S probably benign Het
Gm6214 A G 3: 140,839,346 noncoding transcript Het
Havcr2 A G 11: 46,456,316 Y40C probably damaging Het
Htra1 T G 7: 130,961,591 V184G probably damaging Het
Hydin A T 8: 110,490,676 I1399F probably benign Het
Igtp T C 11: 58,206,648 L215P probably damaging Het
Kctd1 T C 18: 14,969,688 E812G possibly damaging Het
Lap3 T C 5: 45,511,279 probably benign Het
Lrp1b C A 2: 40,601,587 A223S probably damaging Het
Mtnr1b A T 9: 15,863,244 V173E probably damaging Het
Nat10 A C 2: 103,721,839 probably benign Het
Ndfip2 T A 14: 105,294,857 V229E probably damaging Het
Nefh G A 11: 4,941,323 T432M probably damaging Het
Nfe2l3 A G 6: 51,457,852 Y464C probably damaging Het
Nrip1 C A 16: 76,293,953 A239S probably damaging Het
Olfml2b A G 1: 170,662,473 S221G probably benign Het
Orc4 G T 2: 48,905,547 S389* probably null Het
P4hb A G 11: 120,571,650 S77P probably damaging Het
Pcyt2 T C 11: 120,617,797 probably null Het
Plagl1 T C 10: 13,128,194 probably benign Het
Poglut1 C T 16: 38,529,595 R272Q probably damaging Het
Rdh5 T C 10: 128,914,221 probably null Het
Rogdi A T 16: 5,013,394 L3* probably null Het
Skap1 T C 11: 96,581,398 *166Q probably null Het
Slc38a4 A G 15: 96,999,551 I461T probably benign Het
Snx31 A C 15: 36,523,455 I360M probably damaging Het
Spata22 A T 11: 73,336,247 K96* probably null Het
Strn3 A T 12: 51,643,223 probably null Het
Trip12 A C 1: 84,759,163 probably benign Het
Upk3a A C 15: 85,019,337 D79A probably damaging Het
Uts2r A T 11: 121,161,279 Y323F probably benign Het
Vmn2r1 A T 3: 64,086,553 N107Y probably damaging Het
Vps13c A T 9: 67,902,839 probably null Het
Wnt7b A G 15: 85,581,374 probably benign Het
Zfp410 T A 12: 84,337,611 probably null Het
Other mutations in Uggt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Uggt1 APN 1 36179552 splice site probably benign
IGL00817:Uggt1 APN 1 36185932 missense probably benign 0.03
IGL01395:Uggt1 APN 1 36155077 missense probably damaging 1.00
IGL01609:Uggt1 APN 1 36182474 missense probably damaging 1.00
IGL01619:Uggt1 APN 1 36161694 missense probably damaging 0.99
IGL02077:Uggt1 APN 1 36176794 missense probably damaging 0.99
IGL02313:Uggt1 APN 1 36184484 missense probably damaging 0.99
IGL02341:Uggt1 APN 1 36164519 makesense probably null
IGL02346:Uggt1 APN 1 36179670 missense probably benign 0.00
IGL02447:Uggt1 APN 1 36150142 missense probably damaging 1.00
IGL02883:Uggt1 APN 1 36177615 missense probably benign 0.03
IGL02930:Uggt1 APN 1 36157456 missense probably benign 0.01
IGL03153:Uggt1 APN 1 36202818 missense possibly damaging 0.94
IGL03162:Uggt1 APN 1 36207956 missense probably damaging 1.00
IGL03170:Uggt1 APN 1 36163261 missense probably damaging 1.00
IGL03266:Uggt1 APN 1 36150048 missense probably damaging 1.00
K3955:Uggt1 UTSW 1 36162353 missense probably benign 0.37
R0037:Uggt1 UTSW 1 36185932 missense probably benign 0.03
R0037:Uggt1 UTSW 1 36185932 missense probably benign 0.03
R0167:Uggt1 UTSW 1 36170197 critical splice donor site probably null
R0373:Uggt1 UTSW 1 36179670 missense probably benign 0.00
R0502:Uggt1 UTSW 1 36159946 missense probably damaging 1.00
R0546:Uggt1 UTSW 1 36195971 missense probably benign 0.00
R0610:Uggt1 UTSW 1 36165506 splice site probably benign
R0671:Uggt1 UTSW 1 36155128 missense probably damaging 1.00
R0760:Uggt1 UTSW 1 36161724 missense possibly damaging 0.68
R0825:Uggt1 UTSW 1 36158143 missense probably benign 0.01
R0827:Uggt1 UTSW 1 36156313 critical splice acceptor site probably null
R0884:Uggt1 UTSW 1 36175078 missense probably benign 0.00
R1112:Uggt1 UTSW 1 36173546 missense possibly damaging 0.54
R1470:Uggt1 UTSW 1 36176796 missense probably benign 0.13
R1470:Uggt1 UTSW 1 36176796 missense probably benign 0.13
R1592:Uggt1 UTSW 1 36202858 missense probably benign 0.04
R1730:Uggt1 UTSW 1 36221261 missense probably benign 0.05
R1923:Uggt1 UTSW 1 36179613 missense probably damaging 0.99
R1970:Uggt1 UTSW 1 36151781 missense probably damaging 1.00
R2086:Uggt1 UTSW 1 36192414 missense probably null 1.00
R2829:Uggt1 UTSW 1 36162294 missense probably benign 0.38
R3431:Uggt1 UTSW 1 36210059 nonsense probably null
R3432:Uggt1 UTSW 1 36210059 nonsense probably null
R3725:Uggt1 UTSW 1 36182507 nonsense probably null
R3880:Uggt1 UTSW 1 36176804 intron probably benign
R4052:Uggt1 UTSW 1 36164489 missense probably damaging 0.98
R4133:Uggt1 UTSW 1 36158159 missense probably damaging 1.00
R4489:Uggt1 UTSW 1 36146668 nonsense probably null
R4570:Uggt1 UTSW 1 36150073 missense probably damaging 1.00
R4866:Uggt1 UTSW 1 36202855 nonsense probably null
R4895:Uggt1 UTSW 1 36156264 missense probably damaging 1.00
R4900:Uggt1 UTSW 1 36202855 nonsense probably null
R5372:Uggt1 UTSW 1 36244060 splice site probably benign
R5385:Uggt1 UTSW 1 36184412 missense probably damaging 1.00
R5652:Uggt1 UTSW 1 36216153 nonsense probably null
R5694:Uggt1 UTSW 1 36179656 missense probably damaging 1.00
R5732:Uggt1 UTSW 1 36161771 splice site probably null
R6191:Uggt1 UTSW 1 36162208 missense probably damaging 0.98
R6247:Uggt1 UTSW 1 36163228 missense probably damaging 1.00
R6259:Uggt1 UTSW 1 36234916 missense probably benign 0.00
R6399:Uggt1 UTSW 1 36163366 missense possibly damaging 0.90
R6439:Uggt1 UTSW 1 36174951 missense possibly damaging 0.95
R6468:Uggt1 UTSW 1 36173450 missense probably benign 0.00
R6788:Uggt1 UTSW 1 36230688 missense probably benign 0.00
R7165:Uggt1 UTSW 1 36155107 missense probably benign 0.41
R7255:Uggt1 UTSW 1 36146106 missense probably damaging 1.00
R7273:Uggt1 UTSW 1 36162221 missense probably damaging 0.99
R7469:Uggt1 UTSW 1 36151733 missense probably damaging 1.00
R7490:Uggt1 UTSW 1 36164508 missense probably benign 0.01
R7570:Uggt1 UTSW 1 36185838 missense probably benign 0.09
R7612:Uggt1 UTSW 1 36163235 missense probably damaging 0.99
R7759:Uggt1 UTSW 1 36146725 missense possibly damaging 0.81
R7792:Uggt1 UTSW 1 36207984 missense probably damaging 1.00
R7816:Uggt1 UTSW 1 36163315 missense possibly damaging 0.95
X0022:Uggt1 UTSW 1 36165555 missense possibly damaging 0.67
Z1088:Uggt1 UTSW 1 36174191 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCCTAGACACATGAGGTC -3'
(R):5'- AGGACTAGGTCATCTCGGTGAG -3'

Sequencing Primer
(F):5'- AGACACATGAGGTCTTCTTACC -3'
(R):5'- GTCCAGGAAGACAGCTTAACTCAG -3'
Posted On2017-02-15