Mutagenetix > Incidental Mutation

Incidental Mutation 'R5893:Cacna1e'

457277

Institutional Source

Beutler Lab

Gene Symbol

Cacna1e

Ensembl Gene

ENSMUSG00000004110

Gene Name

calcium channel, voltage-dependent, R type, alpha 1E subunit

Synonyms

Cchra1, alpha1E, Cav2.3

MMRRC Submission

044094-MU

Accession Numbers

Genbank: NM_009782; MGI: 106217

Essential gene?

Probably non essential (E-score: 0.139) question?

Stock #

R5893 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

154390731-154884501 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 154437323 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 1486 (F1486I)

Ref Sequence

ENSEMBL: ENSMUSP00000148507 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004214] [ENSMUST00000187541] [ENSMUST00000211821]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000004214
AA Change: F1240I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000004214
Gene: ENSMUSG00000004110
AA Change: F1240I

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	1	55	6.7e-10	PFAM
Pfam:Ion_trans	168	407	3.3e-56	PFAM
Pfam:PKD_channel	257	401	3.3e-7	PFAM
low complexity region	409	414	N/A	INTRINSIC
low complexity region	455	469	N/A	INTRINSIC
low complexity region	496	514	N/A	INTRINSIC
low complexity region	604	620	N/A	INTRINSIC
low complexity region	626	640	N/A	INTRINSIC
coiled coil region	793	823	N/A	INTRINSIC
Pfam:Ion_trans	847	1128	2.3e-63	PFAM
Pfam:Ion_trans	1172	1429	2.6e-65	PFAM
Pfam:PKD_channel	1256	1424	2.8e-10	PFAM
Pfam:GPHH	1431	1500	1.3e-37	PFAM
Ca_chan_IQ	1555	1589	5.93e-13	SMART
low complexity region	1701	1717	N/A	INTRINSIC
low complexity region	1729	1742	N/A	INTRINSIC
low complexity region	1764	1780	N/A	INTRINSIC
low complexity region	1789	1804	N/A	INTRINSIC
low complexity region	1808	1822	N/A	INTRINSIC
low complexity region	1832	1846	N/A	INTRINSIC
low complexity region	1867	1878	N/A	INTRINSIC
low complexity region	1936	1946	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000187541
AA Change: F1548I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140937
Gene: ENSMUSG00000004110
AA Change: F1548I

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	128	351	8.5e-54	PFAM
PDB:4DEX\|B	354	462	6e-36	PDB
Pfam:Ion_trans	511	703	2.2e-46	PFAM
Pfam:PKD_channel	565	710	1.4e-6	PFAM
low complexity region	717	722	N/A	INTRINSIC
low complexity region	763	777	N/A	INTRINSIC
low complexity region	804	822	N/A	INTRINSIC
low complexity region	912	928	N/A	INTRINSIC
low complexity region	934	948	N/A	INTRINSIC
coiled coil region	1101	1131	N/A	INTRINSIC
low complexity region	1162	1175	N/A	INTRINSIC
Pfam:Ion_trans	1191	1425	4.3e-55	PFAM
Pfam:Ion_trans	1515	1725	5.3e-60	PFAM
Pfam:PKD_channel	1565	1732	4.7e-10	PFAM
Ca_chan_IQ	1863	1897	5.93e-13	SMART
low complexity region	2009	2025	N/A	INTRINSIC
low complexity region	2037	2050	N/A	INTRINSIC
low complexity region	2072	2088	N/A	INTRINSIC
low complexity region	2097	2112	N/A	INTRINSIC
low complexity region	2116	2130	N/A	INTRINSIC
low complexity region	2140	2154	N/A	INTRINSIC
low complexity region	2175	2186	N/A	INTRINSIC
low complexity region	2244	2254	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000211821
AA Change: F1486I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.8685

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

95% (73/77)

MGI Phenotype

FUNCTION: This gene encodes an integral membrane protein that belongs to the calcium channel alpha-1 subunits family. Voltage-sensitive calcium channels mediate the entry of calcium ions into excitable cells and are also involved in a variety of calcium-dependent processes. Voltage-dependent calcium channels are multi-subunit complexes, comprised of alpha-1, alpha-2, beta and delta subunits in a 1:1:1:1 ratio. The isoform alpha-1E gives rise to R-type calcium currents and belongs to the high-voltage activated group. Calcium channels containing the alpha-1E subunit may be involved in the modulation of neuronal firing patterns, an important component of information processing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered R-type Ca2+ channels, increased timidity and body weight, impaired glucose tolerance, reduced locomotor activity, and lack of the cocaine stimulation of locomotor response. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, knock-out(3) Targeted, other(3) Gene trapped(1)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	T	A	19: 57,215,853	R35S	probably benign	Het
Acacb	A	T	5: 114,229,851	I1637F	probably benign	Het
Adamts18	A	T	8: 113,773,077	C402S	probably damaging	Het
Adra2b	T	A	2: 127,364,482	D306E	probably benign	Het
Ammecr1l	C	T	18: 31,778,920	T263I	probably damaging	Het
Antxr1	T	C	6: 87,137,259	I509V	probably benign	Het
Bahcc1	A	G	11: 120,285,430	E1967G	probably damaging	Het
Brap	T	A	5: 121,679,342	Y337*	probably null	Het
Brca2	T	C	5: 150,569,138	V3206A	probably benign	Het
C330027C09Rik	A	G	16: 48,997,500	S78G	probably benign	Het
Cbx4	A	G	11: 119,082,190	Y120H	probably damaging	Het
Ccar2	T	A	14: 70,151,351	Q137L	probably benign	Het
Ceacam12	A	G	7: 18,069,374	D235G	probably damaging	Het
Celsr1	A	G	15: 85,904,014	V2679A	probably benign	Het
Champ1	C	T	8: 13,878,777	P312S	probably benign	Het
Chst5	A	G	8: 111,890,196	L264S	probably damaging	Het
Colec10	T	A	15: 54,410,789	F4L	probably benign	Het
Cyp2a4	G	A	7: 26,308,928	G165D	probably damaging	Het
Cyp2c29	G	C	19: 39,330,389	A438P	possibly damaging	Het
Dlat	A	G	9: 50,644,139		probably benign	Het
Dmxl2	A	G	9: 54,387,420	V2457A	possibly damaging	Het
Dnah7a	A	G	1: 53,457,785	M3104T	possibly damaging	Het
Dock8	C	T	19: 25,122,447	H645Y	probably damaging	Het
Ehbp1l1	T	C	19: 5,718,431	E948G	probably benign	Het
Eps8l2	C	T	7: 141,357,624	R384C	probably damaging	Het
Fam174a	A	T	1: 95,325,159	N162I	probably damaging	Het
Fbp2	T	A	13: 62,837,102	N335I	probably benign	Het
Foxred2	C	A	15: 77,947,144	G490C	probably damaging	Het
Fyttd1	T	G	16: 32,898,913	D200E	probably damaging	Het
Gdf15	A	T	8: 70,629,823	V211E	possibly damaging	Het
Gm13084	T	A	4: 143,810,468	Y431F	probably damaging	Het
Gm13178	C	T	4: 144,703,196	V408I	probably benign	Het
Gm5065	A	T	7: 5,359,624	T85S	probably benign	Het
Gm6214	A	G	3: 140,839,346		noncoding transcript	Het
Havcr2	A	G	11: 46,456,316	Y40C	probably damaging	Het
Htra1	T	G	7: 130,961,591	V184G	probably damaging	Het
Hydin	A	T	8: 110,490,676	I1399F	probably benign	Het
Igtp	T	C	11: 58,206,648	L215P	probably damaging	Het
Kctd1	T	C	18: 14,969,688	E812G	possibly damaging	Het
Lap3	T	C	5: 45,511,279		probably benign	Het
Lrp1b	C	A	2: 40,601,587	A223S	probably damaging	Het
Mtnr1b	A	T	9: 15,863,244	V173E	probably damaging	Het
Nat10	A	C	2: 103,721,839		probably benign	Het
Ndfip2	T	A	14: 105,294,857	V229E	probably damaging	Het
Nefh	G	A	11: 4,941,323	T432M	probably damaging	Het
Nfe2l3	A	G	6: 51,457,852	Y464C	probably damaging	Het
Nrip1	C	A	16: 76,293,953	A239S	probably damaging	Het
Olfml2b	A	G	1: 170,662,473	S221G	probably benign	Het
Orc4	G	T	2: 48,905,547	S389*	probably null	Het
P4hb	A	G	11: 120,571,650	S77P	probably damaging	Het
Pcyt2	T	C	11: 120,617,797		probably null	Het
Plagl1	T	C	10: 13,128,194		probably benign	Het
Poglut1	C	T	16: 38,529,595	R272Q	probably damaging	Het
Rdh5	T	C	10: 128,914,221		probably null	Het
Rogdi	A	T	16: 5,013,394	L3*	probably null	Het
Skap1	T	C	11: 96,581,398	*166Q	probably null	Het
Slc38a4	A	G	15: 96,999,551	I461T	probably benign	Het
Snx31	A	C	15: 36,523,455	I360M	probably damaging	Het
Spata22	A	T	11: 73,336,247	K96*	probably null	Het
Strn3	A	T	12: 51,643,223		probably null	Het
Trip12	A	C	1: 84,759,163		probably benign	Het
Uggt1	A	T	1: 36,227,628		probably null	Het
Upk3a	A	C	15: 85,019,337	D79A	probably damaging	Het
Uts2r	A	T	11: 121,161,279	Y323F	probably benign	Het
Vmn2r1	A	T	3: 64,086,553	N107Y	probably damaging	Het
Vps13c	A	T	9: 67,902,839		probably null	Het
Wnt7b	A	G	15: 85,581,374		probably benign	Het
Zfp410	T	A	12: 84,337,611		probably null	Het

Other mutations in Cacna1e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Cacna1e	APN	1	154403683	missense	probably damaging	0.99
IGL01086:Cacna1e	APN	1	154471601	missense	probably benign	0.04
IGL01302:Cacna1e	APN	1	154443907	missense	probably damaging	1.00
IGL01386:Cacna1e	APN	1	154472377	missense	probably benign	0.18
IGL01573:Cacna1e	APN	1	154471367	missense	probably benign
IGL01676:Cacna1e	APN	1	154398476	missense	probably damaging	1.00
IGL01676:Cacna1e	APN	1	154412450	missense	probably damaging	1.00
IGL01762:Cacna1e	APN	1	154471373	missense	possibly damaging	0.78
IGL01801:Cacna1e	APN	1	154471340	missense	probably null	0.00
IGL01895:Cacna1e	APN	1	154443900	missense	probably damaging	1.00
IGL02391:Cacna1e	APN	1	154421113	missense	probably damaging	1.00
IGL02399:Cacna1e	APN	1	154403747	missense	probably damaging	1.00
IGL02659:Cacna1e	APN	1	154426528	missense	probably damaging	1.00
IGL02686:Cacna1e	APN	1	154493409	missense	probably damaging	1.00
IGL02838:Cacna1e	APN	1	154445648	missense	probably damaging	1.00
IGL02958:Cacna1e	APN	1	154465741	missense	probably damaging	1.00
IGL02981:Cacna1e	APN	1	154471425	missense	probably benign	0.15
IGL03120:Cacna1e	APN	1	154443881	missense	probably damaging	1.00
IGL03232:Cacna1e	APN	1	154493358	missense	probably damaging	1.00
IGL03310:Cacna1e	APN	1	154442251	missense	probably damaging	1.00
IGL03342:Cacna1e	APN	1	154466944	critical splice donor site	probably null
bezoar	UTSW	1	154436554	splice site	probably null
hairball	UTSW	1	154479305	missense	probably damaging	0.97
N/A - 535:Cacna1e	UTSW	1	154465764	missense	probably damaging	1.00
R0122:Cacna1e	UTSW	1	154443901	missense	probably damaging	1.00
R0143:Cacna1e	UTSW	1	154448947	splice site	probably null
R0314:Cacna1e	UTSW	1	154442251	missense	probably damaging	1.00
R0366:Cacna1e	UTSW	1	154416138	missense	probably benign	0.03
R0626:Cacna1e	UTSW	1	154488817	missense	probably damaging	0.99
R0739:Cacna1e	UTSW	1	154442278	missense	probably damaging	0.97
R1272:Cacna1e	UTSW	1	154444968	missense	probably damaging	1.00
R1300:Cacna1e	UTSW	1	154398673	missense	probably benign
R1340:Cacna1e	UTSW	1	154472657	missense	probably damaging	1.00
R1440:Cacna1e	UTSW	1	154561806	missense	possibly damaging	0.63
R1449:Cacna1e	UTSW	1	154485662	critical splice donor site	probably null
R1538:Cacna1e	UTSW	1	154561758	missense	probably damaging	0.99
R1542:Cacna1e	UTSW	1	154477779	missense	probably benign	0.01
R1560:Cacna1e	UTSW	1	154421104	nonsense	probably null
R1748:Cacna1e	UTSW	1	154486569	missense	possibly damaging	0.92
R1749:Cacna1e	UTSW	1	154444000	missense	probably damaging	1.00
R1912:Cacna1e	UTSW	1	154436449	missense	probably damaging	1.00
R1968:Cacna1e	UTSW	1	154700494	missense	probably damaging	1.00
R1993:Cacna1e	UTSW	1	154477817	missense	probably damaging	0.97
R1994:Cacna1e	UTSW	1	154477817	missense	probably damaging	0.97
R2191:Cacna1e	UTSW	1	154443845	missense	probably damaging	1.00
R2291:Cacna1e	UTSW	1	154403683	missense	probably damaging	0.99
R2417:Cacna1e	UTSW	1	154472193	missense	probably damaging	1.00
R3608:Cacna1e	UTSW	1	154416085	missense	probably benign	0.08
R3757:Cacna1e	UTSW	1	154633696	missense	probably damaging	0.97
R3890:Cacna1e	UTSW	1	154483553	missense	probably damaging	1.00
R4015:Cacna1e	UTSW	1	154482585	missense	probably damaging	1.00
R4088:Cacna1e	UTSW	1	154412183	splice site	probably null
R4275:Cacna1e	UTSW	1	154493325	missense	probably damaging	1.00
R4282:Cacna1e	UTSW	1	154426550	missense	probably benign	0.04
R4297:Cacna1e	UTSW	1	154398731	missense	probably benign	0.37
R4356:Cacna1e	UTSW	1	154443981	missense	probably damaging	1.00
R4510:Cacna1e	UTSW	1	154561833	missense	probably damaging	1.00
R4511:Cacna1e	UTSW	1	154561833	missense	probably damaging	1.00
R4577:Cacna1e	UTSW	1	154402027	missense	possibly damaging	0.92
R4590:Cacna1e	UTSW	1	154436519	missense	possibly damaging	0.87
R4601:Cacna1e	UTSW	1	154471613	missense	probably benign
R4622:Cacna1e	UTSW	1	154471565	missense	possibly damaging	0.81
R4626:Cacna1e	UTSW	1	154482548	splice site	probably null
R4694:Cacna1e	UTSW	1	154437266	critical splice donor site	probably null
R4727:Cacna1e	UTSW	1	154436468	nonsense	probably null
R4839:Cacna1e	UTSW	1	154421058	missense	probably damaging	1.00
R4851:Cacna1e	UTSW	1	154436554	splice site	probably null
R4894:Cacna1e	UTSW	1	154488805	nonsense	probably null
R4934:Cacna1e	UTSW	1	154481634	nonsense	probably null
R4979:Cacna1e	UTSW	1	154413993	missense	probably damaging	1.00
R5077:Cacna1e	UTSW	1	154561729	critical splice donor site	probably null
R5128:Cacna1e	UTSW	1	154402021	missense	probably damaging	0.98
R5214:Cacna1e	UTSW	1	154701364	missense	possibly damaging	0.93
R5274:Cacna1e	UTSW	1	154700504	missense	probably damaging	0.98
R5388:Cacna1e	UTSW	1	154477796	missense	probably damaging	1.00
R5416:Cacna1e	UTSW	1	154465779	missense	probably damaging	1.00
R5469:Cacna1e	UTSW	1	154443937	missense	probably damaging	1.00
R5475:Cacna1e	UTSW	1	154725709	missense	possibly damaging	0.53
R5607:Cacna1e	UTSW	1	154471340	missense	probably benign	0.00
R5615:Cacna1e	UTSW	1	154412170	missense	probably damaging	1.00
R5616:Cacna1e	UTSW	1	154442194	missense	probably damaging	1.00
R5627:Cacna1e	UTSW	1	154635858	missense	probably damaging	0.98
R5707:Cacna1e	UTSW	1	154633717	missense	probably damaging	1.00
R5756:Cacna1e	UTSW	1	154471637	missense	probably benign	0.00
R6117:Cacna1e	UTSW	1	154561791	missense	possibly damaging	0.68
R6134:Cacna1e	UTSW	1	154701291	missense	probably damaging	1.00
R6190:Cacna1e	UTSW	1	154486570	missense	possibly damaging	0.47
R6279:Cacna1e	UTSW	1	154425932	missense	probably benign	0.38
R6295:Cacna1e	UTSW	1	154442173	missense	probably damaging	0.98
R6300:Cacna1e	UTSW	1	154425932	missense	probably benign	0.38
R6320:Cacna1e	UTSW	1	154441524	missense	possibly damaging	0.76
R6375:Cacna1e	UTSW	1	154479305	missense	probably damaging	0.97
R6830:Cacna1e	UTSW	1	154413974	critical splice donor site	probably null
R6842:Cacna1e	UTSW	1	154483117	missense	probably damaging	1.00
R7023:Cacna1e	UTSW	1	154725693	missense	probably null	0.85
R7081:Cacna1e	UTSW	1	154700383	missense	possibly damaging	0.82
R7085:Cacna1e	UTSW	1	154473746	splice site	probably null
R7108:Cacna1e	UTSW	1	154468995	frame shift	probably null
R7142:Cacna1e	UTSW	1	154412484	missense	probably damaging	1.00
R7250:Cacna1e	UTSW	1	154700489	missense	possibly damaging	0.93
R7332:Cacna1e	UTSW	1	154725801	missense	possibly damaging	0.89
R7410:Cacna1e	UTSW	1	154472234	missense	probably benign	0.13
R7502:Cacna1e	UTSW	1	154468988	missense	probably null	0.35
R7556:Cacna1e	UTSW	1	154472673	missense	probably benign	0.28
R7563:Cacna1e	UTSW	1	154471416	missense	probably benign	0.00
R7573:Cacna1e	UTSW	1	154726165	intron	probably benign
R7689:Cacna1e	UTSW	1	154398803	missense	probably benign	0.01
R7699:Cacna1e	UTSW	1	154443928	missense	probably damaging	1.00
R7744:Cacna1e	UTSW	1	154465792	missense	probably damaging	1.00
R7754:Cacna1e	UTSW	1	154413117	missense	probably damaging	0.97
R7787:Cacna1e	UTSW	1	154482568	missense	probably damaging	0.98
R7818:Cacna1e	UTSW	1	154398406	missense	probably damaging	1.00
R7838:Cacna1e	UTSW	1	154471403	missense	probably benign	0.08
R7849:Cacna1e	UTSW	1	154633718	missense	probably damaging	1.00
R8011:Cacna1e	UTSW	1	154465822	missense	probably benign	0.01
R8094:Cacna1e	UTSW	1	154561770	missense	probably damaging	1.00
R8162:Cacna1e	UTSW	1	154701567	splice site	probably null
R8202:Cacna1e	UTSW	1	154398449	missense	probably benign
R8280:Cacna1e	UTSW	1	154469093	missense	probably damaging	0.97
R8354:Cacna1e	UTSW	1	154398568	missense	probably damaging	1.00
R8385:Cacna1e	UTSW	1	154443941	missense	probably damaging	0.98
R8532:Cacna1e	UTSW	1	154465764	missense	probably damaging	1.00
R8902:Cacna1e	UTSW	1	154473886	missense	probably benign	0.01
R8926:Cacna1e	UTSW	1	154701334	missense	possibly damaging	0.84
R8947:Cacna1e	UTSW	1	154402150	missense	probably benign	0.10
R9094:Cacna1e	UTSW	1	154479318	missense	possibly damaging	0.93
R9126:Cacna1e	UTSW	1	154467764	missense	probably benign	0.01
R9175:Cacna1e	UTSW	1	154398568	missense	probably damaging	1.00
R9286:Cacna1e	UTSW	1	154413099	missense	probably damaging	1.00
R9377:Cacna1e	UTSW	1	154485712	missense	possibly damaging	0.88
R9452:Cacna1e	UTSW	1	154413974	critical splice donor site	probably null
R9463:Cacna1e	UTSW	1	154481665	missense	probably damaging	1.00
R9513:Cacna1e	UTSW	1	154442287	missense	probably damaging	1.00
R9534:Cacna1e	UTSW	1	154444947	missense	possibly damaging	0.65
R9562:Cacna1e	UTSW	1	154407740	missense	probably benign	0.01
RF008:Cacna1e	UTSW	1	154442136	missense	probably damaging	1.00
X0062:Cacna1e	UTSW	1	154412492	missense	probably damaging	1.00
Z1176:Cacna1e	UTSW	1	154635850	missense	probably damaging	0.98
Z1177:Cacna1e	UTSW	1	154442292	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TATTGCTCAGGATGGATGAAGTAGAC -3'
(R):5'- TGAGGAGTTCCCAAATTAGTAAAGG -3'

Sequencing Primer
(F):5'- TAGACTTCCAACACGAAGGGGAC -3'
(R):5'- CAGAATTTCGGGTTAGAAACAGG -3'

Posted On

2017-02-15