Incidental Mutation 'R5893:Chst5'
ID 457304
Institutional Source Beutler Lab
Gene Symbol Chst5
Ensembl Gene ENSMUSG00000031952
Gene Name carbohydrate sulfotransferase 5
Synonyms I-GlcNAc6ST, GST-4
MMRRC Submission 044094-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5893 (G1)
Quality Score 214
Status Validated
Chromosome 8
Chromosomal Location 112615767-112636831 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 112616828 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 264 (L264S)
Ref Sequence ENSEMBL: ENSMUSP00000034430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034430]
AlphaFold Q9QUP4
Predicted Effect probably damaging
Transcript: ENSMUST00000034430
AA Change: L264S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034430
Gene: ENSMUSG00000031952
AA Change: L264S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Sulfotransfer_1 40 357 1.2e-25 PFAM
Pfam:Sulfotransfer_3 41 294 4.7e-16 PFAM
low complexity region 363 376 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme that catalyzes the transfer of a sulfate group to the GlcNAc residues of keratan. Keratan sulfate helps maintain corneal transparency. Defects in this gene are a cause of macular corneal dystrophy (MCD). [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutation of this gene results in thinner corneas that show abnormally close collagen fibrillar packing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AAdacl4fm3 C T 4: 144,429,766 (GRCm39) V408I probably benign Het
Ablim1 T A 19: 57,204,285 (GRCm39) R35S probably benign Het
Acacb A T 5: 114,367,912 (GRCm39) I1637F probably benign Het
Adamts18 A T 8: 114,499,709 (GRCm39) C402S probably damaging Het
Adra2b T A 2: 127,206,402 (GRCm39) D306E probably benign Het
Ammecr1l C T 18: 31,911,973 (GRCm39) T263I probably damaging Het
Antxr1 T C 6: 87,114,241 (GRCm39) I509V probably benign Het
Bahcc1 A G 11: 120,176,256 (GRCm39) E1967G probably damaging Het
Brap T A 5: 121,817,405 (GRCm39) Y337* probably null Het
Brca2 T C 5: 150,492,603 (GRCm39) V3206A probably benign Het
Cacna1e A T 1: 154,313,069 (GRCm39) F1486I probably damaging Het
Cbx4 A G 11: 118,973,016 (GRCm39) Y120H probably damaging Het
Ccar2 T A 14: 70,388,800 (GRCm39) Q137L probably benign Het
Ceacam12 A G 7: 17,803,299 (GRCm39) D235G probably damaging Het
Celsr1 A G 15: 85,788,215 (GRCm39) V2679A probably benign Het
Champ1 C T 8: 13,928,777 (GRCm39) P312S probably benign Het
Cip2a A G 16: 48,817,863 (GRCm39) S78G probably benign Het
Colec10 T A 15: 54,274,185 (GRCm39) F4L probably benign Het
Cyp2a4 G A 7: 26,008,353 (GRCm39) G165D probably damaging Het
Cyp2c29 G C 19: 39,318,833 (GRCm39) A438P possibly damaging Het
Dlat A G 9: 50,555,439 (GRCm39) probably benign Het
Dmxl2 A G 9: 54,294,704 (GRCm39) V2457A possibly damaging Het
Dnah7a A G 1: 53,496,944 (GRCm39) M3104T possibly damaging Het
Dock8 C T 19: 25,099,811 (GRCm39) H645Y probably damaging Het
Ehbp1l1 T C 19: 5,768,459 (GRCm39) E948G probably benign Het
Eps8l2 C T 7: 140,937,537 (GRCm39) R384C probably damaging Het
Fam174a A T 1: 95,252,884 (GRCm39) N162I probably damaging Het
Fbp2 T A 13: 62,984,916 (GRCm39) N335I probably benign Het
Foxred2 C A 15: 77,831,344 (GRCm39) G490C probably damaging Het
Fyttd1 T G 16: 32,719,283 (GRCm39) D200E probably damaging Het
Gdf15 A T 8: 71,082,473 (GRCm39) V211E possibly damaging Het
Gm6214 A G 3: 140,545,107 (GRCm39) noncoding transcript Het
Havcr2 A G 11: 46,347,143 (GRCm39) Y40C probably damaging Het
Htra1 T G 7: 130,563,321 (GRCm39) V184G probably damaging Het
Hydin A T 8: 111,217,308 (GRCm39) I1399F probably benign Het
Igtp T C 11: 58,097,474 (GRCm39) L215P probably damaging Het
Kctd1 T C 18: 15,102,745 (GRCm39) E812G possibly damaging Het
Lap3 T C 5: 45,668,621 (GRCm39) probably benign Het
Lgalsl2 A T 7: 5,362,623 (GRCm39) T85S probably benign Het
Lrp1b C A 2: 40,491,599 (GRCm39) A223S probably damaging Het
Mtnr1b A T 9: 15,774,540 (GRCm39) V173E probably damaging Het
Nat10 A C 2: 103,552,184 (GRCm39) probably benign Het
Ndfip2 T A 14: 105,532,291 (GRCm39) V229E probably damaging Het
Nefh G A 11: 4,891,323 (GRCm39) T432M probably damaging Het
Nfe2l3 A G 6: 51,434,832 (GRCm39) Y464C probably damaging Het
Nrip1 C A 16: 76,090,841 (GRCm39) A239S probably damaging Het
Olfml2b A G 1: 170,490,042 (GRCm39) S221G probably benign Het
Orc4 G T 2: 48,795,559 (GRCm39) S389* probably null Het
P4hb A G 11: 120,462,476 (GRCm39) S77P probably damaging Het
Pcyt2 T C 11: 120,508,623 (GRCm39) probably null Het
Plagl1 T C 10: 13,003,938 (GRCm39) probably benign Het
Poglut1 C T 16: 38,349,957 (GRCm39) R272Q probably damaging Het
Pramel26 T A 4: 143,537,038 (GRCm39) Y431F probably damaging Het
Rdh5 T C 10: 128,750,090 (GRCm39) probably null Het
Rogdi A T 16: 4,831,258 (GRCm39) L3* probably null Het
Skap1 T C 11: 96,472,224 (GRCm39) *166Q probably null Het
Slc38a4 A G 15: 96,897,432 (GRCm39) I461T probably benign Het
Snx31 A C 15: 36,523,601 (GRCm39) I360M probably damaging Het
Spata22 A T 11: 73,227,073 (GRCm39) K96* probably null Het
Strn3 A T 12: 51,690,006 (GRCm39) probably null Het
Trip12 A C 1: 84,736,884 (GRCm39) probably benign Het
Uggt1 A T 1: 36,266,709 (GRCm39) probably null Het
Upk3a A C 15: 84,903,538 (GRCm39) D79A probably damaging Het
Uts2r A T 11: 121,052,105 (GRCm39) Y323F probably benign Het
Vmn2r1 A T 3: 63,993,974 (GRCm39) N107Y probably damaging Het
Vps13c A T 9: 67,810,121 (GRCm39) probably null Het
Wnt7b A G 15: 85,465,575 (GRCm39) probably benign Het
Zfp410 T A 12: 84,384,385 (GRCm39) probably null Het
Other mutations in Chst5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Chst5 APN 8 112,617,314 (GRCm39) missense probably damaging 1.00
IGL02336:Chst5 APN 8 112,616,949 (GRCm39) missense probably damaging 0.99
IGL02634:Chst5 APN 8 112,617,477 (GRCm39) missense probably damaging 1.00
R0606:Chst5 UTSW 8 112,617,551 (GRCm39) missense probably benign 0.05
R1552:Chst5 UTSW 8 112,616,912 (GRCm39) missense probably damaging 0.99
R2094:Chst5 UTSW 8 112,617,176 (GRCm39) missense probably benign 0.01
R3769:Chst5 UTSW 8 112,616,513 (GRCm39) missense possibly damaging 0.67
R4135:Chst5 UTSW 8 112,616,816 (GRCm39) missense probably damaging 1.00
R4872:Chst5 UTSW 8 112,617,192 (GRCm39) missense possibly damaging 0.61
R5658:Chst5 UTSW 8 112,617,422 (GRCm39) missense probably damaging 1.00
R5759:Chst5 UTSW 8 112,616,842 (GRCm39) missense probably benign 0.25
R6657:Chst5 UTSW 8 112,616,906 (GRCm39) missense probably benign 0.00
R6731:Chst5 UTSW 8 112,616,676 (GRCm39) missense probably benign 0.00
R7406:Chst5 UTSW 8 112,617,245 (GRCm39) missense probably benign 0.00
R7535:Chst5 UTSW 8 112,616,795 (GRCm39) missense probably damaging 1.00
R7727:Chst5 UTSW 8 112,617,557 (GRCm39) missense probably benign 0.25
R7835:Chst5 UTSW 8 112,617,234 (GRCm39) missense probably damaging 1.00
R7843:Chst5 UTSW 8 112,617,204 (GRCm39) missense probably benign 0.00
R8257:Chst5 UTSW 8 112,617,092 (GRCm39) missense probably damaging 1.00
R8324:Chst5 UTSW 8 112,617,140 (GRCm39) missense probably benign 0.06
R8444:Chst5 UTSW 8 112,617,395 (GRCm39) missense probably damaging 1.00
R8458:Chst5 UTSW 8 112,617,422 (GRCm39) missense probably damaging 1.00
R9001:Chst5 UTSW 8 112,616,534 (GRCm39) missense probably benign
R9223:Chst5 UTSW 8 112,617,492 (GRCm39) missense probably benign 0.13
R9517:Chst5 UTSW 8 112,616,652 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TGGTCTTGAAGGCTTCACG -3'
(R):5'- GTGCGCTTCTTTAACCTACAGG -3'

Sequencing Primer
(F):5'- GAAGGCTTCACGGCGCG -3'
(R):5'- TCAACCTGCGCATCGTG -3'
Posted On 2017-02-15