Mutagenetix > Incidental Mutation

Incidental Mutation 'R5893:Adamts18'

457305

Institutional Source

Beutler Lab

Gene Symbol

Adamts18

Ensembl Gene

ENSMUSG00000053399

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 18

Synonyms

E130314N14Rik

MMRRC Submission

044094-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.137) question?

Stock #

R5893 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

113697126-113848738 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 113773077 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 402 (C402S)

Ref Sequence

ENSEMBL: ENSMUSP00000090801 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093113] [ENSMUST00000212665]

AlphaFold

Q4VC17

Predicted Effect

probably damaging
Transcript: ENSMUST00000093113
AA Change: C402S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000090801
Gene: ENSMUSG00000053399
AA Change: C402S

Domain	Start	End	E-Value	Type
signal peptide	1	47	N/A	INTRINSIC
Pfam:Pep_M12B_propep	63	203	3.4e-37	PFAM
Pfam:Reprolysin_5	292	473	1.3e-14	PFAM
Pfam:Reprolysin_4	294	494	2.6e-11	PFAM
Pfam:Reprolysin	294	498	2.7e-30	PFAM
Pfam:Reprolysin_2	311	488	1.7e-14	PFAM
Pfam:Reprolysin_3	315	447	1.5e-11	PFAM
TSP1	592	644	7.37e-17	SMART
Pfam:ADAM_spacer1	749	861	1.7e-38	PFAM
TSP1	878	932	1.55e-1	SMART
TSP1	934	992	5.07e-6	SMART
TSP1	994	1049	1.65e-5	SMART
TSP1	1055	1116	1.71e-3	SMART
TSP1	1125	1171	5.27e-4	SMART
Pfam:PLAC	1186	1216	1.2e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000212437

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212527

Predicted Effect

probably benign
Transcript: ENSMUST00000212665

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213061

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213076

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213078

Meta Mutation Damage Score

0.9073

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

95% (73/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may regulate hemostatic balance and function as a tumor suppressor. Mutations in this gene may be associated with microcornea, myopic chorioretinal atrophy, and telecanthus (MMCAT) and cone-rod dystrophy in human patients. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a floxed allele exhibit some fertility defects. Mice homozygous for a null allele exhibit growth and eye defects and increased susceptibility to chemically induced tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	T	A	19: 57,215,853	R35S	probably benign	Het
Acacb	A	T	5: 114,229,851	I1637F	probably benign	Het
Adra2b	T	A	2: 127,364,482	D306E	probably benign	Het
Ammecr1l	C	T	18: 31,778,920	T263I	probably damaging	Het
Antxr1	T	C	6: 87,137,259	I509V	probably benign	Het
Bahcc1	A	G	11: 120,285,430	E1967G	probably damaging	Het
Brap	T	A	5: 121,679,342	Y337*	probably null	Het
Brca2	T	C	5: 150,569,138	V3206A	probably benign	Het
C330027C09Rik	A	G	16: 48,997,500	S78G	probably benign	Het
Cacna1e	A	T	1: 154,437,323	F1486I	probably damaging	Het
Cbx4	A	G	11: 119,082,190	Y120H	probably damaging	Het
Ccar2	T	A	14: 70,151,351	Q137L	probably benign	Het
Ceacam12	A	G	7: 18,069,374	D235G	probably damaging	Het
Celsr1	A	G	15: 85,904,014	V2679A	probably benign	Het
Champ1	C	T	8: 13,878,777	P312S	probably benign	Het
Chst5	A	G	8: 111,890,196	L264S	probably damaging	Het
Colec10	T	A	15: 54,410,789	F4L	probably benign	Het
Cyp2a4	G	A	7: 26,308,928	G165D	probably damaging	Het
Cyp2c29	G	C	19: 39,330,389	A438P	possibly damaging	Het
Dlat	A	G	9: 50,644,139		probably benign	Het
Dmxl2	A	G	9: 54,387,420	V2457A	possibly damaging	Het
Dnah7a	A	G	1: 53,457,785	M3104T	possibly damaging	Het
Dock8	C	T	19: 25,122,447	H645Y	probably damaging	Het
Ehbp1l1	T	C	19: 5,718,431	E948G	probably benign	Het
Eps8l2	C	T	7: 141,357,624	R384C	probably damaging	Het
Fam174a	A	T	1: 95,325,159	N162I	probably damaging	Het
Fbp2	T	A	13: 62,837,102	N335I	probably benign	Het
Foxred2	C	A	15: 77,947,144	G490C	probably damaging	Het
Fyttd1	T	G	16: 32,898,913	D200E	probably damaging	Het
Gdf15	A	T	8: 70,629,823	V211E	possibly damaging	Het
Gm13084	T	A	4: 143,810,468	Y431F	probably damaging	Het
Gm13178	C	T	4: 144,703,196	V408I	probably benign	Het
Gm5065	A	T	7: 5,359,624	T85S	probably benign	Het
Gm6214	A	G	3: 140,839,346		noncoding transcript	Het
Havcr2	A	G	11: 46,456,316	Y40C	probably damaging	Het
Htra1	T	G	7: 130,961,591	V184G	probably damaging	Het
Hydin	A	T	8: 110,490,676	I1399F	probably benign	Het
Igtp	T	C	11: 58,206,648	L215P	probably damaging	Het
Kctd1	T	C	18: 14,969,688	E812G	possibly damaging	Het
Lap3	T	C	5: 45,511,279		probably benign	Het
Lrp1b	C	A	2: 40,601,587	A223S	probably damaging	Het
Mtnr1b	A	T	9: 15,863,244	V173E	probably damaging	Het
Nat10	A	C	2: 103,721,839		probably benign	Het
Ndfip2	T	A	14: 105,294,857	V229E	probably damaging	Het
Nefh	G	A	11: 4,941,323	T432M	probably damaging	Het
Nfe2l3	A	G	6: 51,457,852	Y464C	probably damaging	Het
Nrip1	C	A	16: 76,293,953	A239S	probably damaging	Het
Olfml2b	A	G	1: 170,662,473	S221G	probably benign	Het
Orc4	G	T	2: 48,905,547	S389*	probably null	Het
P4hb	A	G	11: 120,571,650	S77P	probably damaging	Het
Pcyt2	T	C	11: 120,617,797		probably null	Het
Plagl1	T	C	10: 13,128,194		probably benign	Het
Poglut1	C	T	16: 38,529,595	R272Q	probably damaging	Het
Rdh5	T	C	10: 128,914,221		probably null	Het
Rogdi	A	T	16: 5,013,394	L3*	probably null	Het
Skap1	T	C	11: 96,581,398	*166Q	probably null	Het
Slc38a4	A	G	15: 96,999,551	I461T	probably benign	Het
Snx31	A	C	15: 36,523,455	I360M	probably damaging	Het
Spata22	A	T	11: 73,336,247	K96*	probably null	Het
Strn3	A	T	12: 51,643,223		probably null	Het
Trip12	A	C	1: 84,759,163		probably benign	Het
Uggt1	A	T	1: 36,227,628		probably null	Het
Upk3a	A	C	15: 85,019,337	D79A	probably damaging	Het
Uts2r	A	T	11: 121,161,279	Y323F	probably benign	Het
Vmn2r1	A	T	3: 64,086,553	N107Y	probably damaging	Het
Vps13c	A	T	9: 67,902,839		probably null	Het
Wnt7b	A	G	15: 85,581,374		probably benign	Het
Zfp410	T	A	12: 84,337,611		probably null	Het

Other mutations in Adamts18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01290:Adamts18	APN	8	113774943	missense	probably damaging	1.00
IGL01548:Adamts18	APN	8	113764299	missense	probably damaging	1.00
IGL01556:Adamts18	APN	8	113845109	missense	probably benign	0.01
IGL01833:Adamts18	APN	8	113743096	missense	probably benign	0.10
IGL02187:Adamts18	APN	8	113713194	missense	possibly damaging	0.93
IGL02551:Adamts18	APN	8	113699072	missense	probably damaging	1.00
IGL02756:Adamts18	APN	8	113714344	splice site	probably benign
IGL03188:Adamts18	APN	8	113699024	missense	probably damaging	1.00
IGL03411:Adamts18	APN	8	113764297	nonsense	probably null
G1patch:Adamts18	UTSW	8	113743201	missense	probably damaging	1.00
R0119:Adamts18	UTSW	8	113774953	missense	possibly damaging	0.94
R0378:Adamts18	UTSW	8	113743117	missense	probably damaging	1.00
R0410:Adamts18	UTSW	8	113714358	nonsense	probably null
R0480:Adamts18	UTSW	8	113738818	missense	possibly damaging	0.93
R0514:Adamts18	UTSW	8	113738769	splice site	probably null
R0924:Adamts18	UTSW	8	113705396	splice site	probably null
R0930:Adamts18	UTSW	8	113705396	splice site	probably null
R1333:Adamts18	UTSW	8	113705173	splice site	probably benign
R1441:Adamts18	UTSW	8	113754562	critical splice donor site	probably null
R2082:Adamts18	UTSW	8	113775333	missense	probably damaging	1.00
R2146:Adamts18	UTSW	8	113845003	missense	possibly damaging	0.58
R2371:Adamts18	UTSW	8	113705261	missense	probably benign	0.36
R3148:Adamts18	UTSW	8	113738858	missense	probably damaging	1.00
R3963:Adamts18	UTSW	8	113777811	missense	probably benign	0.00
R4056:Adamts18	UTSW	8	113737580	nonsense	probably null
R4486:Adamts18	UTSW	8	113713193	missense	probably benign	0.00
R4608:Adamts18	UTSW	8	113737613	missense	probably damaging	1.00
R4624:Adamts18	UTSW	8	113773168	nonsense	probably null
R4626:Adamts18	UTSW	8	113773168	nonsense	probably null
R4627:Adamts18	UTSW	8	113773168	nonsense	probably null
R4628:Adamts18	UTSW	8	113773168	nonsense	probably null
R4629:Adamts18	UTSW	8	113773168	nonsense	probably null
R4710:Adamts18	UTSW	8	113706926	missense	probably damaging	0.98
R4959:Adamts18	UTSW	8	113736725	nonsense	probably null
R4973:Adamts18	UTSW	8	113736725	nonsense	probably null
R4976:Adamts18	UTSW	8	113699010	missense	probably benign	0.31
R5119:Adamts18	UTSW	8	113699010	missense	probably benign	0.31
R5141:Adamts18	UTSW	8	113775270	missense	probably damaging	1.00
R5422:Adamts18	UTSW	8	113698974	missense	probably benign	0.06
R5587:Adamts18	UTSW	8	113775360	nonsense	probably null
R5868:Adamts18	UTSW	8	113777748	missense	possibly damaging	0.69
R5906:Adamts18	UTSW	8	113709619	missense	probably benign	0.00
R5942:Adamts18	UTSW	8	113777748	missense	probably benign	0.01
R6006:Adamts18	UTSW	8	113706974	missense	probably damaging	1.00
R6608:Adamts18	UTSW	8	113775279	missense	probably damaging	1.00
R6725:Adamts18	UTSW	8	113743201	missense	probably damaging	1.00
R7002:Adamts18	UTSW	8	113775290	missense	possibly damaging	0.69
R7276:Adamts18	UTSW	8	113775264	missense	probably damaging	0.99
R7292:Adamts18	UTSW	8	113709645	missense	probably benign	0.00
R7411:Adamts18	UTSW	8	113777730	missense	probably damaging	0.99
R7685:Adamts18	UTSW	8	113713223	missense	probably damaging	1.00
R7737:Adamts18	UTSW	8	113736934	splice site	probably null
R7860:Adamts18	UTSW	8	113775276	missense	probably damaging	1.00
R7936:Adamts18	UTSW	8	113767128	missense	probably damaging	1.00
R8197:Adamts18	UTSW	8	113754595	missense	probably damaging	1.00
R8363:Adamts18	UTSW	8	113767163	missense	probably damaging	1.00
R8759:Adamts18	UTSW	8	113706992	missense	probably damaging	1.00
R8934:Adamts18	UTSW	8	113736878	missense	possibly damaging	0.90
R9405:Adamts18	UTSW	8	113703398	missense	probably damaging	1.00
R9422:Adamts18	UTSW	8	113775278	missense	probably damaging	1.00
R9450:Adamts18	UTSW	8	113764310	missense	probably benign	0.10
R9475:Adamts18	UTSW	8	113777938	missense	possibly damaging	0.93
Z1088:Adamts18	UTSW	8	113775440	missense	possibly damaging	0.86
Z1176:Adamts18	UTSW	8	113743168	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- GTAACACGGTTCTCAGAATGTGTG -3'
(R):5'- TGCCTCCACAGCTACAAAGG -3'

Sequencing Primer
(F):5'- CTCAGAATGTGTGATTGGGAAC -3'
(R):5'- GGCACAATCATCACTCTTTAATCC -3'

Posted On

2017-02-15