Mutagenetix > Incidental Mutation

Incidental Mutation 'R5893:Dmxl2'

457308

Institutional Source

Beutler Lab

Gene Symbol

Dmxl2

Ensembl Gene

ENSMUSG00000041268

Gene Name

Dmx-like 2

Synonyms

E130119P06Rik, 6430411K14Rik

MMRRC Submission

044094-MU

Accession Numbers

NCBI RefSeq: NM_172771.2; MGI:2444630

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5893 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

54365158-54501626 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 54387420 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 2457 (V2457A)

Ref Sequence

ENSEMBL: ENSMUSP00000113705 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000118163] [ENSMUST00000118600]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000118163
AA Change: V2457A

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000113705
Gene: ENSMUSG00000041268
AA Change: V2457A

Domain	Start	End	E-Value	Type
WD40	43	84	4.58e1	SMART
WD40	100	136	2.28e2	SMART
WD40	159	198	2.57e-2	SMART
WD40	221	269	1.03e-1	SMART
low complexity region	420	440	N/A	INTRINSIC
WD40	741	793	1.42e2	SMART
low complexity region	861	875	N/A	INTRINSIC
low complexity region	945	961	N/A	INTRINSIC
WD40	985	1029	1.15e1	SMART
WD40	1236	1273	2.84e2	SMART
Pfam:Rav1p_C	1430	1903	1.5e-71	PFAM
low complexity region	1978	1993	N/A	INTRINSIC
coiled coil region	2118	2146	N/A	INTRINSIC
low complexity region	2189	2204	N/A	INTRINSIC
low complexity region	2251	2266	N/A	INTRINSIC
low complexity region	2472	2490	N/A	INTRINSIC
low complexity region	2635	2649	N/A	INTRINSIC
low complexity region	2744	2766	N/A	INTRINSIC
WD40	2774	2809	5.73e0	SMART
WD40	2813	2852	8.88e0	SMART
WD40	2859	2901	2.67e-1	SMART
WD40	2907	2946	2.57e-2	SMART
WD40	2949	2988	3.61e-6	SMART
WD40	3001	3039	8.25e0	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000118600
AA Change: V2456A

SMART Domains

Protein: ENSMUSP00000113693
Gene: ENSMUSG00000041268
AA Change: V2456A

Domain	Start	End	E-Value	Type
WD40	43	84	4.58e1	SMART
WD40	100	136	2.28e2	SMART
WD40	159	198	2.57e-2	SMART
WD40	221	269	1.03e-1	SMART
low complexity region	420	440	N/A	INTRINSIC
WD40	741	793	1.42e2	SMART
low complexity region	861	875	N/A	INTRINSIC
low complexity region	945	961	N/A	INTRINSIC
WD40	985	1029	1.15e1	SMART
WD40	1236	1273	2.84e2	SMART
low complexity region	1426	1436	N/A	INTRINSIC
Pfam:Rav1p_C	1447	1903	4.2e-68	PFAM
low complexity region	1978	1993	N/A	INTRINSIC
coiled coil region	2118	2146	N/A	INTRINSIC
low complexity region	2189	2204	N/A	INTRINSIC
low complexity region	2251	2266	N/A	INTRINSIC
low complexity region	2471	2489	N/A	INTRINSIC
low complexity region	2722	2744	N/A	INTRINSIC
WD40	2752	2787	5.73e0	SMART
WD40	2791	2830	8.88e0	SMART
WD40	2837	2879	2.67e-1	SMART
WD40	2885	2924	2.57e-2	SMART
WD40	2927	2966	3.61e-6	SMART
WD40	2979	3017	8.25e0	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000123709
AA Change: V1658A

SMART Domains

Protein: ENSMUSP00000119959
Gene: ENSMUSG00000041268
AA Change: V1658A

Domain	Start	End	E-Value	Type
low complexity region	63	77	N/A	INTRINSIC
low complexity region	147	163	N/A	INTRINSIC
WD40	187	231	1.15e1	SMART
WD40	438	475	2.84e2	SMART
Pfam:Rav1p_C	632	1105	9.1e-72	PFAM
low complexity region	1180	1195	N/A	INTRINSIC
coiled coil region	1319	1347	N/A	INTRINSIC
low complexity region	1391	1406	N/A	INTRINSIC
low complexity region	1453	1468	N/A	INTRINSIC
low complexity region	1674	1692	N/A	INTRINSIC
low complexity region	1925	1947	N/A	INTRINSIC
WD40	1955	1990	5.73e0	SMART
WD40	1994	2033	8.88e0	SMART
WD40	2040	2082	2.67e-1	SMART
WD40	2088	2127	2.57e-2	SMART
WD40	2130	2169	3.61e-6	SMART
WD40	2182	2220	8.25e0	SMART

Meta Mutation Damage Score

0.0857

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

95% (73/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 12 WD domains. Proteins with WD domains are involved in many functions including participation in signal transduction pathways. Participation of the encoded protein in regulation of the Notch signaling pathway has been demonstrated in vitro using several human cell lines (PMID:20810660). A gene encoding a similar protein is located on chromosome 5. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete prenatal lethality. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(2)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	T	A	19: 57,215,853	R35S	probably benign	Het
Acacb	A	T	5: 114,229,851	I1637F	probably benign	Het
Adamts18	A	T	8: 113,773,077	C402S	probably damaging	Het
Adra2b	T	A	2: 127,364,482	D306E	probably benign	Het
Ammecr1l	C	T	18: 31,778,920	T263I	probably damaging	Het
Antxr1	T	C	6: 87,137,259	I509V	probably benign	Het
Bahcc1	A	G	11: 120,285,430	E1967G	probably damaging	Het
Brap	T	A	5: 121,679,342	Y337*	probably null	Het
Brca2	T	C	5: 150,569,138	V3206A	probably benign	Het
C330027C09Rik	A	G	16: 48,997,500	S78G	probably benign	Het
Cacna1e	A	T	1: 154,437,323	F1486I	probably damaging	Het
Cbx4	A	G	11: 119,082,190	Y120H	probably damaging	Het
Ccar2	T	A	14: 70,151,351	Q137L	probably benign	Het
Ceacam12	A	G	7: 18,069,374	D235G	probably damaging	Het
Celsr1	A	G	15: 85,904,014	V2679A	probably benign	Het
Champ1	C	T	8: 13,878,777	P312S	probably benign	Het
Chst5	A	G	8: 111,890,196	L264S	probably damaging	Het
Colec10	T	A	15: 54,410,789	F4L	probably benign	Het
Cyp2a4	G	A	7: 26,308,928	G165D	probably damaging	Het
Cyp2c29	G	C	19: 39,330,389	A438P	possibly damaging	Het
Dlat	A	G	9: 50,644,139		probably benign	Het
Dnah7a	A	G	1: 53,457,785	M3104T	possibly damaging	Het
Dock8	C	T	19: 25,122,447	H645Y	probably damaging	Het
Ehbp1l1	T	C	19: 5,718,431	E948G	probably benign	Het
Eps8l2	C	T	7: 141,357,624	R384C	probably damaging	Het
Fam174a	A	T	1: 95,325,159	N162I	probably damaging	Het
Fbp2	T	A	13: 62,837,102	N335I	probably benign	Het
Foxred2	C	A	15: 77,947,144	G490C	probably damaging	Het
Fyttd1	T	G	16: 32,898,913	D200E	probably damaging	Het
Gdf15	A	T	8: 70,629,823	V211E	possibly damaging	Het
Gm13084	T	A	4: 143,810,468	Y431F	probably damaging	Het
Gm13178	C	T	4: 144,703,196	V408I	probably benign	Het
Gm5065	A	T	7: 5,359,624	T85S	probably benign	Het
Gm6214	A	G	3: 140,839,346		noncoding transcript	Het
Havcr2	A	G	11: 46,456,316	Y40C	probably damaging	Het
Htra1	T	G	7: 130,961,591	V184G	probably damaging	Het
Hydin	A	T	8: 110,490,676	I1399F	probably benign	Het
Igtp	T	C	11: 58,206,648	L215P	probably damaging	Het
Kctd1	T	C	18: 14,969,688	E812G	possibly damaging	Het
Lap3	T	C	5: 45,511,279		probably benign	Het
Lrp1b	C	A	2: 40,601,587	A223S	probably damaging	Het
Mtnr1b	A	T	9: 15,863,244	V173E	probably damaging	Het
Nat10	A	C	2: 103,721,839		probably benign	Het
Ndfip2	T	A	14: 105,294,857	V229E	probably damaging	Het
Nefh	G	A	11: 4,941,323	T432M	probably damaging	Het
Nfe2l3	A	G	6: 51,457,852	Y464C	probably damaging	Het
Nrip1	C	A	16: 76,293,953	A239S	probably damaging	Het
Olfml2b	A	G	1: 170,662,473	S221G	probably benign	Het
Orc4	G	T	2: 48,905,547	S389*	probably null	Het
P4hb	A	G	11: 120,571,650	S77P	probably damaging	Het
Pcyt2	T	C	11: 120,617,797		probably null	Het
Plagl1	T	C	10: 13,128,194		probably benign	Het
Poglut1	C	T	16: 38,529,595	R272Q	probably damaging	Het
Rdh5	T	C	10: 128,914,221		probably null	Het
Rogdi	A	T	16: 5,013,394	L3*	probably null	Het
Skap1	T	C	11: 96,581,398	*166Q	probably null	Het
Slc38a4	A	G	15: 96,999,551	I461T	probably benign	Het
Snx31	A	C	15: 36,523,455	I360M	probably damaging	Het
Spata22	A	T	11: 73,336,247	K96*	probably null	Het
Strn3	A	T	12: 51,643,223		probably null	Het
Trip12	A	C	1: 84,759,163		probably benign	Het
Uggt1	A	T	1: 36,227,628		probably null	Het
Upk3a	A	C	15: 85,019,337	D79A	probably damaging	Het
Uts2r	A	T	11: 121,161,279	Y323F	probably benign	Het
Vmn2r1	A	T	3: 64,086,553	N107Y	probably damaging	Het
Vps13c	A	T	9: 67,902,839		probably null	Het
Wnt7b	A	G	15: 85,581,374		probably benign	Het
Zfp410	T	A	12: 84,337,611		probably null	Het

Other mutations in Dmxl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Dmxl2	APN	9	54401704	missense	probably benign
IGL00226:Dmxl2	APN	9	54415993	missense	probably damaging	1.00
IGL00419:Dmxl2	APN	9	54406667	missense	probably damaging	0.96
IGL00551:Dmxl2	APN	9	54450838	missense	probably damaging	1.00
IGL00765:Dmxl2	APN	9	54415422	unclassified	probably benign
IGL00852:Dmxl2	APN	9	54423313	nonsense	probably null
IGL00857:Dmxl2	APN	9	54376320	missense	probably benign	0.32
IGL00952:Dmxl2	APN	9	54416882	missense	probably damaging	0.99
IGL01139:Dmxl2	APN	9	54458964	missense	probably damaging	1.00
IGL01346:Dmxl2	APN	9	54415475	missense	probably damaging	1.00
IGL01538:Dmxl2	APN	9	54445376	splice site	probably benign
IGL01645:Dmxl2	APN	9	54378733	missense	possibly damaging	0.93
IGL02096:Dmxl2	APN	9	54401065	missense	possibly damaging	0.89
IGL02104:Dmxl2	APN	9	54404015	nonsense	probably null
IGL02145:Dmxl2	APN	9	54374697	missense	probably benign	0.29
IGL02210:Dmxl2	APN	9	54404049	missense	probably damaging	1.00
IGL02238:Dmxl2	APN	9	54445433	missense	probably damaging	1.00
IGL02255:Dmxl2	APN	9	54393768	missense	probably benign	0.06
IGL02364:Dmxl2	APN	9	54393843	missense	probably benign	0.02
IGL02423:Dmxl2	APN	9	54393748	missense	possibly damaging	0.89
IGL02440:Dmxl2	APN	9	54406615	missense	probably damaging	0.98
IGL02546:Dmxl2	APN	9	54366414	utr 3 prime	probably benign
IGL02668:Dmxl2	APN	9	54416945	missense	probably damaging	1.00
IGL03229:Dmxl2	APN	9	54404172	missense	probably damaging	1.00
IGL03244:Dmxl2	APN	9	54416371	missense	probably damaging	1.00
IGL03277:Dmxl2	APN	9	54404220	missense	probably damaging	1.00
IGL03399:Dmxl2	APN	9	54446672	missense	probably damaging	1.00
BB003:Dmxl2	UTSW	9	54428042	missense	probably benign	0.01
BB013:Dmxl2	UTSW	9	54428042	missense	probably benign	0.01
I2288:Dmxl2	UTSW	9	54401793	missense	probably damaging	1.00
P0014:Dmxl2	UTSW	9	54401764	missense	probably damaging	1.00
R0411:Dmxl2	UTSW	9	54378939	missense	probably damaging	1.00
R0422:Dmxl2	UTSW	9	54399940	critical splice donor site	probably null
R0432:Dmxl2	UTSW	9	54416951	missense	probably benign	0.01
R0436:Dmxl2	UTSW	9	54383750	missense	probably damaging	1.00
R0538:Dmxl2	UTSW	9	54393836	missense	probably benign	0.06
R0603:Dmxl2	UTSW	9	54405906	missense	possibly damaging	0.95
R0605:Dmxl2	UTSW	9	54419945	missense	probably benign	0.01
R0625:Dmxl2	UTSW	9	54382702	missense	probably benign
R0626:Dmxl2	UTSW	9	54416554	missense	probably damaging	1.00
R0736:Dmxl2	UTSW	9	54378817	missense	probably damaging	0.99
R0847:Dmxl2	UTSW	9	54405828	missense	probably damaging	1.00
R0855:Dmxl2	UTSW	9	54366440	missense	probably benign	0.03
R0962:Dmxl2	UTSW	9	54446412	missense	probably damaging	0.99
R1015:Dmxl2	UTSW	9	54367765	missense	probably benign	0.32
R1084:Dmxl2	UTSW	9	54416433	missense	probably damaging	1.00
R1328:Dmxl2	UTSW	9	54396249	missense	probably benign	0.12
R1401:Dmxl2	UTSW	9	54415428	critical splice donor site	probably null
R1503:Dmxl2	UTSW	9	54446988	nonsense	probably null
R1609:Dmxl2	UTSW	9	54409263	missense	possibly damaging	0.90
R1613:Dmxl2	UTSW	9	54382027	missense	probably benign
R1660:Dmxl2	UTSW	9	54451030	missense	possibly damaging	0.68
R1712:Dmxl2	UTSW	9	54401485	missense	probably benign	0.00
R1772:Dmxl2	UTSW	9	54423224	splice site	probably benign
R1832:Dmxl2	UTSW	9	54460949	missense	probably damaging	0.97
R1922:Dmxl2	UTSW	9	54401523	missense	probably benign
R2104:Dmxl2	UTSW	9	54415564	missense	probably damaging	1.00
R2109:Dmxl2	UTSW	9	54393813	missense	probably benign	0.06
R2145:Dmxl2	UTSW	9	54415910	missense	probably damaging	1.00
R2199:Dmxl2	UTSW	9	54376243	missense	probably benign	0.35
R2352:Dmxl2	UTSW	9	54393862	missense	probably damaging	1.00
R2516:Dmxl2	UTSW	9	54400094	missense	probably damaging	1.00
R2981:Dmxl2	UTSW	9	54393702	missense	probably damaging	1.00
R3430:Dmxl2	UTSW	9	54477461	missense	possibly damaging	0.94
R3625:Dmxl2	UTSW	9	54393643	missense	probably benign	0.23
R3725:Dmxl2	UTSW	9	54393769	missense	probably damaging	1.00
R3787:Dmxl2	UTSW	9	54369878	missense	probably damaging	1.00
R4002:Dmxl2	UTSW	9	54473832	splice site	probably benign
R4004:Dmxl2	UTSW	9	54446390	missense	probably benign	0.04
R4005:Dmxl2	UTSW	9	54446390	missense	probably benign	0.04
R4012:Dmxl2	UTSW	9	54379013	splice site	probably null
R4014:Dmxl2	UTSW	9	54378709	splice site	probably null
R4115:Dmxl2	UTSW	9	54446988	nonsense	probably null
R4232:Dmxl2	UTSW	9	54419909	missense	possibly damaging	0.89
R4388:Dmxl2	UTSW	9	54396267	missense	probably damaging	1.00
R4513:Dmxl2	UTSW	9	54419884	missense	probably null	0.17
R4552:Dmxl2	UTSW	9	54451763	missense	probably damaging	1.00
R4609:Dmxl2	UTSW	9	54446512	missense	probably damaging	1.00
R4625:Dmxl2	UTSW	9	54404120	missense	possibly damaging	0.55
R4694:Dmxl2	UTSW	9	54446905	missense	probably benign	0.04
R4711:Dmxl2	UTSW	9	54450924	missense	probably benign	0.37
R4715:Dmxl2	UTSW	9	54446405	splice site	probably null
R4746:Dmxl2	UTSW	9	54451796	missense	probably benign	0.04
R4789:Dmxl2	UTSW	9	54379815	missense	probably benign	0.30
R4825:Dmxl2	UTSW	9	54404041	missense	probably benign	0.01
R4911:Dmxl2	UTSW	9	54411653	missense	probably damaging	1.00
R4995:Dmxl2	UTSW	9	54501441	utr 5 prime	probably benign
R5026:Dmxl2	UTSW	9	54416676	missense	probably damaging	1.00
R5118:Dmxl2	UTSW	9	54460987	missense	probably damaging	1.00
R5174:Dmxl2	UTSW	9	54445484	splice site	probably null
R5288:Dmxl2	UTSW	9	54378757	missense	probably benign
R5373:Dmxl2	UTSW	9	54369189	intron	probably benign
R5374:Dmxl2	UTSW	9	54369189	intron	probably benign
R5385:Dmxl2	UTSW	9	54378757	missense	probably benign
R5386:Dmxl2	UTSW	9	54378757	missense	probably benign
R5418:Dmxl2	UTSW	9	54374651	critical splice donor site	probably null
R5540:Dmxl2	UTSW	9	54393857	missense	probably benign	0.21
R5568:Dmxl2	UTSW	9	54423359	splice site	probably null
R5733:Dmxl2	UTSW	9	54376266	missense	possibly damaging	0.64
R5758:Dmxl2	UTSW	9	54472964	missense	probably benign	0.28
R5759:Dmxl2	UTSW	9	54375508	missense	probably damaging	1.00
R6030:Dmxl2	UTSW	9	54393673	missense	probably benign	0.18
R6030:Dmxl2	UTSW	9	54393673	missense	probably benign	0.18
R6041:Dmxl2	UTSW	9	54416753	missense	probably damaging	1.00
R6174:Dmxl2	UTSW	9	54393727	missense	probably damaging	1.00
R6278:Dmxl2	UTSW	9	54415762	missense	probably damaging	1.00
R6307:Dmxl2	UTSW	9	54382706	missense	possibly damaging	0.68
R6349:Dmxl2	UTSW	9	54419909	missense	possibly damaging	0.89
R6404:Dmxl2	UTSW	9	54375536	missense	probably damaging	1.00
R6516:Dmxl2	UTSW	9	54416676	missense	probably damaging	1.00
R6712:Dmxl2	UTSW	9	54411624	missense	probably damaging	1.00
R6747:Dmxl2	UTSW	9	54416088	missense	probably damaging	1.00
R6769:Dmxl2	UTSW	9	54416524	missense	probably damaging	1.00
R6771:Dmxl2	UTSW	9	54416524	missense	probably damaging	1.00
R6800:Dmxl2	UTSW	9	54409183	missense	probably damaging	1.00
R6891:Dmxl2	UTSW	9	54480380	missense	probably damaging	0.99
R6920:Dmxl2	UTSW	9	54472212	missense	probably damaging	1.00
R6979:Dmxl2	UTSW	9	54450879	missense	possibly damaging	0.49
R7147:Dmxl2	UTSW	9	54416729	missense	probably benign	0.06
R7327:Dmxl2	UTSW	9	54401585	missense	probably damaging	1.00
R7462:Dmxl2	UTSW	9	54366632	splice site	probably null
R7526:Dmxl2	UTSW	9	54400957	missense	possibly damaging	0.47
R7569:Dmxl2	UTSW	9	54415987	missense	possibly damaging	0.51
R7622:Dmxl2	UTSW	9	54472218	missense	probably damaging	0.99
R7638:Dmxl2	UTSW	9	54457794	missense	unknown
R7703:Dmxl2	UTSW	9	54461086	missense	probably benign	0.01
R7768:Dmxl2	UTSW	9	54380939	missense	probably damaging	1.00
R7926:Dmxl2	UTSW	9	54428042	missense	probably benign	0.01
R7969:Dmxl2	UTSW	9	54446881	missense	possibly damaging	0.85
R8007:Dmxl2	UTSW	9	54383691	nonsense	probably null
R8200:Dmxl2	UTSW	9	54480346	missense	probably benign
R8311:Dmxl2	UTSW	9	54446933	missense	probably benign	0.00
R8320:Dmxl2	UTSW	9	54383759	missense	probably benign
R8377:Dmxl2	UTSW	9	54378748	missense	probably damaging	1.00
R8400:Dmxl2	UTSW	9	54383753	missense	probably benign	0.03
R8509:Dmxl2	UTSW	9	54428057	nonsense	probably null
R8698:Dmxl2	UTSW	9	54374669	missense	probably benign	0.10
R8768:Dmxl2	UTSW	9	54393821	missense	possibly damaging	0.83
R8770:Dmxl2	UTSW	9	54404014	missense	probably benign	0.01
R8799:Dmxl2	UTSW	9	54419743	critical splice donor site	probably null
R8840:Dmxl2	UTSW	9	54401855	missense	possibly damaging	0.58
R8898:Dmxl2	UTSW	9	54401657	missense	probably benign	0.01
R8954:Dmxl2	UTSW	9	54473872	missense	probably benign	0.04
R9083:Dmxl2	UTSW	9	54409264	missense	probably benign	0.29
R9114:Dmxl2	UTSW	9	54400037	missense
R9115:Dmxl2	UTSW	9	54401727	missense	probably benign
R9263:Dmxl2	UTSW	9	54451661	missense	probably benign	0.01
R9272:Dmxl2	UTSW	9	54404120	missense	possibly damaging	0.55
R9577:Dmxl2	UTSW	9	54416380	missense	unknown
R9673:Dmxl2	UTSW	9	54387556	missense	probably damaging	1.00
R9722:Dmxl2	UTSW	9	54416608	missense	probably benign	0.00
R9726:Dmxl2	UTSW	9	54415712	missense	probably benign	0.09
R9797:Dmxl2	UTSW	9	54450903	missense	probably benign	0.00
X0064:Dmxl2	UTSW	9	54401713	missense	probably benign
Z1177:Dmxl2	UTSW	9	54382034	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CTGGTTTATACCTAAGTCCCAGAG -3'
(R):5'- AGAGCTTCCGTCCCATTCAG -3'

Sequencing Primer
(F):5'- CCTAAGTCCCAGAGGATTTTAATTTC -3'
(R):5'- ATTCAGCACCTCCTGTGGC -3'

Posted On

2017-02-15