Incidental Mutation 'R5893:Dmxl2'
ID 457308
Institutional Source Beutler Lab
Gene Symbol Dmxl2
Ensembl Gene ENSMUSG00000041268
Gene Name Dmx-like 2
Synonyms E130119P06Rik, 6430411K14Rik
MMRRC Submission 044094-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5893 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 54272442-54408910 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 54294704 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 2457 (V2457A)
Ref Sequence ENSEMBL: ENSMUSP00000113705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118163] [ENSMUST00000118600]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000118163
AA Change: V2457A

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113705
Gene: ENSMUSG00000041268
AA Change: V2457A

DomainStartEndE-ValueType
WD40 43 84 4.58e1 SMART
WD40 100 136 2.28e2 SMART
WD40 159 198 2.57e-2 SMART
WD40 221 269 1.03e-1 SMART
low complexity region 420 440 N/A INTRINSIC
WD40 741 793 1.42e2 SMART
low complexity region 861 875 N/A INTRINSIC
low complexity region 945 961 N/A INTRINSIC
WD40 985 1029 1.15e1 SMART
WD40 1236 1273 2.84e2 SMART
Pfam:Rav1p_C 1430 1903 1.5e-71 PFAM
low complexity region 1978 1993 N/A INTRINSIC
coiled coil region 2118 2146 N/A INTRINSIC
low complexity region 2189 2204 N/A INTRINSIC
low complexity region 2251 2266 N/A INTRINSIC
low complexity region 2472 2490 N/A INTRINSIC
low complexity region 2635 2649 N/A INTRINSIC
low complexity region 2744 2766 N/A INTRINSIC
WD40 2774 2809 5.73e0 SMART
WD40 2813 2852 8.88e0 SMART
WD40 2859 2901 2.67e-1 SMART
WD40 2907 2946 2.57e-2 SMART
WD40 2949 2988 3.61e-6 SMART
WD40 3001 3039 8.25e0 SMART
Predicted Effect unknown
Transcript: ENSMUST00000118600
AA Change: V2456A
SMART Domains Protein: ENSMUSP00000113693
Gene: ENSMUSG00000041268
AA Change: V2456A

DomainStartEndE-ValueType
WD40 43 84 4.58e1 SMART
WD40 100 136 2.28e2 SMART
WD40 159 198 2.57e-2 SMART
WD40 221 269 1.03e-1 SMART
low complexity region 420 440 N/A INTRINSIC
WD40 741 793 1.42e2 SMART
low complexity region 861 875 N/A INTRINSIC
low complexity region 945 961 N/A INTRINSIC
WD40 985 1029 1.15e1 SMART
WD40 1236 1273 2.84e2 SMART
low complexity region 1426 1436 N/A INTRINSIC
Pfam:Rav1p_C 1447 1903 4.2e-68 PFAM
low complexity region 1978 1993 N/A INTRINSIC
coiled coil region 2118 2146 N/A INTRINSIC
low complexity region 2189 2204 N/A INTRINSIC
low complexity region 2251 2266 N/A INTRINSIC
low complexity region 2471 2489 N/A INTRINSIC
low complexity region 2722 2744 N/A INTRINSIC
WD40 2752 2787 5.73e0 SMART
WD40 2791 2830 8.88e0 SMART
WD40 2837 2879 2.67e-1 SMART
WD40 2885 2924 2.57e-2 SMART
WD40 2927 2966 3.61e-6 SMART
WD40 2979 3017 8.25e0 SMART
Predicted Effect unknown
Transcript: ENSMUST00000123709
AA Change: V1658A
SMART Domains Protein: ENSMUSP00000119959
Gene: ENSMUSG00000041268
AA Change: V1658A

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
WD40 187 231 1.15e1 SMART
WD40 438 475 2.84e2 SMART
Pfam:Rav1p_C 632 1105 9.1e-72 PFAM
low complexity region 1180 1195 N/A INTRINSIC
coiled coil region 1319 1347 N/A INTRINSIC
low complexity region 1391 1406 N/A INTRINSIC
low complexity region 1453 1468 N/A INTRINSIC
low complexity region 1674 1692 N/A INTRINSIC
low complexity region 1925 1947 N/A INTRINSIC
WD40 1955 1990 5.73e0 SMART
WD40 1994 2033 8.88e0 SMART
WD40 2040 2082 2.67e-1 SMART
WD40 2088 2127 2.57e-2 SMART
WD40 2130 2169 3.61e-6 SMART
WD40 2182 2220 8.25e0 SMART
Meta Mutation Damage Score 0.0857 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 12 WD domains. Proteins with WD domains are involved in many functions including participation in signal transduction pathways. Participation of the encoded protein in regulation of the Notch signaling pathway has been demonstrated in vitro using several human cell lines (PMID:20810660). A gene encoding a similar protein is located on chromosome 5. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete prenatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(2)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AAdacl4fm3 C T 4: 144,429,766 (GRCm39) V408I probably benign Het
Ablim1 T A 19: 57,204,285 (GRCm39) R35S probably benign Het
Acacb A T 5: 114,367,912 (GRCm39) I1637F probably benign Het
Adamts18 A T 8: 114,499,709 (GRCm39) C402S probably damaging Het
Adra2b T A 2: 127,206,402 (GRCm39) D306E probably benign Het
Ammecr1l C T 18: 31,911,973 (GRCm39) T263I probably damaging Het
Antxr1 T C 6: 87,114,241 (GRCm39) I509V probably benign Het
Bahcc1 A G 11: 120,176,256 (GRCm39) E1967G probably damaging Het
Brap T A 5: 121,817,405 (GRCm39) Y337* probably null Het
Brca2 T C 5: 150,492,603 (GRCm39) V3206A probably benign Het
Cacna1e A T 1: 154,313,069 (GRCm39) F1486I probably damaging Het
Cbx4 A G 11: 118,973,016 (GRCm39) Y120H probably damaging Het
Ccar2 T A 14: 70,388,800 (GRCm39) Q137L probably benign Het
Ceacam12 A G 7: 17,803,299 (GRCm39) D235G probably damaging Het
Celsr1 A G 15: 85,788,215 (GRCm39) V2679A probably benign Het
Champ1 C T 8: 13,928,777 (GRCm39) P312S probably benign Het
Chst5 A G 8: 112,616,828 (GRCm39) L264S probably damaging Het
Cip2a A G 16: 48,817,863 (GRCm39) S78G probably benign Het
Colec10 T A 15: 54,274,185 (GRCm39) F4L probably benign Het
Cyp2a4 G A 7: 26,008,353 (GRCm39) G165D probably damaging Het
Cyp2c29 G C 19: 39,318,833 (GRCm39) A438P possibly damaging Het
Dlat A G 9: 50,555,439 (GRCm39) probably benign Het
Dnah7a A G 1: 53,496,944 (GRCm39) M3104T possibly damaging Het
Dock8 C T 19: 25,099,811 (GRCm39) H645Y probably damaging Het
Ehbp1l1 T C 19: 5,768,459 (GRCm39) E948G probably benign Het
Eps8l2 C T 7: 140,937,537 (GRCm39) R384C probably damaging Het
Fam174a A T 1: 95,252,884 (GRCm39) N162I probably damaging Het
Fbp2 T A 13: 62,984,916 (GRCm39) N335I probably benign Het
Foxred2 C A 15: 77,831,344 (GRCm39) G490C probably damaging Het
Fyttd1 T G 16: 32,719,283 (GRCm39) D200E probably damaging Het
Gdf15 A T 8: 71,082,473 (GRCm39) V211E possibly damaging Het
Gm6214 A G 3: 140,545,107 (GRCm39) noncoding transcript Het
Havcr2 A G 11: 46,347,143 (GRCm39) Y40C probably damaging Het
Htra1 T G 7: 130,563,321 (GRCm39) V184G probably damaging Het
Hydin A T 8: 111,217,308 (GRCm39) I1399F probably benign Het
Igtp T C 11: 58,097,474 (GRCm39) L215P probably damaging Het
Kctd1 T C 18: 15,102,745 (GRCm39) E812G possibly damaging Het
Lap3 T C 5: 45,668,621 (GRCm39) probably benign Het
Lgalsl2 A T 7: 5,362,623 (GRCm39) T85S probably benign Het
Lrp1b C A 2: 40,491,599 (GRCm39) A223S probably damaging Het
Mtnr1b A T 9: 15,774,540 (GRCm39) V173E probably damaging Het
Nat10 A C 2: 103,552,184 (GRCm39) probably benign Het
Ndfip2 T A 14: 105,532,291 (GRCm39) V229E probably damaging Het
Nefh G A 11: 4,891,323 (GRCm39) T432M probably damaging Het
Nfe2l3 A G 6: 51,434,832 (GRCm39) Y464C probably damaging Het
Nrip1 C A 16: 76,090,841 (GRCm39) A239S probably damaging Het
Olfml2b A G 1: 170,490,042 (GRCm39) S221G probably benign Het
Orc4 G T 2: 48,795,559 (GRCm39) S389* probably null Het
P4hb A G 11: 120,462,476 (GRCm39) S77P probably damaging Het
Pcyt2 T C 11: 120,508,623 (GRCm39) probably null Het
Plagl1 T C 10: 13,003,938 (GRCm39) probably benign Het
Poglut1 C T 16: 38,349,957 (GRCm39) R272Q probably damaging Het
Pramel26 T A 4: 143,537,038 (GRCm39) Y431F probably damaging Het
Rdh5 T C 10: 128,750,090 (GRCm39) probably null Het
Rogdi A T 16: 4,831,258 (GRCm39) L3* probably null Het
Skap1 T C 11: 96,472,224 (GRCm39) *166Q probably null Het
Slc38a4 A G 15: 96,897,432 (GRCm39) I461T probably benign Het
Snx31 A C 15: 36,523,601 (GRCm39) I360M probably damaging Het
Spata22 A T 11: 73,227,073 (GRCm39) K96* probably null Het
Strn3 A T 12: 51,690,006 (GRCm39) probably null Het
Trip12 A C 1: 84,736,884 (GRCm39) probably benign Het
Uggt1 A T 1: 36,266,709 (GRCm39) probably null Het
Upk3a A C 15: 84,903,538 (GRCm39) D79A probably damaging Het
Uts2r A T 11: 121,052,105 (GRCm39) Y323F probably benign Het
Vmn2r1 A T 3: 63,993,974 (GRCm39) N107Y probably damaging Het
Vps13c A T 9: 67,810,121 (GRCm39) probably null Het
Wnt7b A G 15: 85,465,575 (GRCm39) probably benign Het
Zfp410 T A 12: 84,384,385 (GRCm39) probably null Het
Other mutations in Dmxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Dmxl2 APN 9 54,308,988 (GRCm39) missense probably benign
IGL00226:Dmxl2 APN 9 54,323,277 (GRCm39) missense probably damaging 1.00
IGL00419:Dmxl2 APN 9 54,313,951 (GRCm39) missense probably damaging 0.96
IGL00551:Dmxl2 APN 9 54,358,122 (GRCm39) missense probably damaging 1.00
IGL00765:Dmxl2 APN 9 54,322,706 (GRCm39) unclassified probably benign
IGL00852:Dmxl2 APN 9 54,330,597 (GRCm39) nonsense probably null
IGL00857:Dmxl2 APN 9 54,283,604 (GRCm39) missense probably benign 0.32
IGL00952:Dmxl2 APN 9 54,324,166 (GRCm39) missense probably damaging 0.99
IGL01139:Dmxl2 APN 9 54,366,248 (GRCm39) missense probably damaging 1.00
IGL01346:Dmxl2 APN 9 54,322,759 (GRCm39) missense probably damaging 1.00
IGL01538:Dmxl2 APN 9 54,352,660 (GRCm39) splice site probably benign
IGL01645:Dmxl2 APN 9 54,286,017 (GRCm39) missense possibly damaging 0.93
IGL02096:Dmxl2 APN 9 54,308,349 (GRCm39) missense possibly damaging 0.89
IGL02104:Dmxl2 APN 9 54,311,299 (GRCm39) nonsense probably null
IGL02145:Dmxl2 APN 9 54,281,981 (GRCm39) missense probably benign 0.29
IGL02210:Dmxl2 APN 9 54,311,333 (GRCm39) missense probably damaging 1.00
IGL02238:Dmxl2 APN 9 54,352,717 (GRCm39) missense probably damaging 1.00
IGL02255:Dmxl2 APN 9 54,301,052 (GRCm39) missense probably benign 0.06
IGL02364:Dmxl2 APN 9 54,301,127 (GRCm39) missense probably benign 0.02
IGL02423:Dmxl2 APN 9 54,301,032 (GRCm39) missense possibly damaging 0.89
IGL02440:Dmxl2 APN 9 54,313,899 (GRCm39) missense probably damaging 0.98
IGL02546:Dmxl2 APN 9 54,273,698 (GRCm39) utr 3 prime probably benign
IGL02668:Dmxl2 APN 9 54,324,229 (GRCm39) missense probably damaging 1.00
IGL03229:Dmxl2 APN 9 54,311,456 (GRCm39) missense probably damaging 1.00
IGL03244:Dmxl2 APN 9 54,323,655 (GRCm39) missense probably damaging 1.00
IGL03277:Dmxl2 APN 9 54,311,504 (GRCm39) missense probably damaging 1.00
IGL03399:Dmxl2 APN 9 54,353,956 (GRCm39) missense probably damaging 1.00
BB003:Dmxl2 UTSW 9 54,335,326 (GRCm39) missense probably benign 0.01
BB013:Dmxl2 UTSW 9 54,335,326 (GRCm39) missense probably benign 0.01
I2288:Dmxl2 UTSW 9 54,309,077 (GRCm39) missense probably damaging 1.00
P0014:Dmxl2 UTSW 9 54,309,048 (GRCm39) missense probably damaging 1.00
R0411:Dmxl2 UTSW 9 54,286,223 (GRCm39) missense probably damaging 1.00
R0422:Dmxl2 UTSW 9 54,307,224 (GRCm39) critical splice donor site probably null
R0432:Dmxl2 UTSW 9 54,324,235 (GRCm39) missense probably benign 0.01
R0436:Dmxl2 UTSW 9 54,291,034 (GRCm39) missense probably damaging 1.00
R0538:Dmxl2 UTSW 9 54,301,120 (GRCm39) missense probably benign 0.06
R0603:Dmxl2 UTSW 9 54,313,190 (GRCm39) missense possibly damaging 0.95
R0605:Dmxl2 UTSW 9 54,327,229 (GRCm39) missense probably benign 0.01
R0625:Dmxl2 UTSW 9 54,289,986 (GRCm39) missense probably benign
R0626:Dmxl2 UTSW 9 54,323,838 (GRCm39) missense probably damaging 1.00
R0736:Dmxl2 UTSW 9 54,286,101 (GRCm39) missense probably damaging 0.99
R0847:Dmxl2 UTSW 9 54,313,112 (GRCm39) missense probably damaging 1.00
R0855:Dmxl2 UTSW 9 54,273,724 (GRCm39) missense probably benign 0.03
R0962:Dmxl2 UTSW 9 54,353,696 (GRCm39) missense probably damaging 0.99
R1015:Dmxl2 UTSW 9 54,275,049 (GRCm39) missense probably benign 0.32
R1084:Dmxl2 UTSW 9 54,323,717 (GRCm39) missense probably damaging 1.00
R1328:Dmxl2 UTSW 9 54,303,533 (GRCm39) missense probably benign 0.12
R1401:Dmxl2 UTSW 9 54,322,712 (GRCm39) critical splice donor site probably null
R1503:Dmxl2 UTSW 9 54,354,272 (GRCm39) nonsense probably null
R1609:Dmxl2 UTSW 9 54,316,547 (GRCm39) missense possibly damaging 0.90
R1613:Dmxl2 UTSW 9 54,289,311 (GRCm39) missense probably benign
R1660:Dmxl2 UTSW 9 54,358,314 (GRCm39) missense possibly damaging 0.68
R1712:Dmxl2 UTSW 9 54,308,769 (GRCm39) missense probably benign 0.00
R1772:Dmxl2 UTSW 9 54,330,508 (GRCm39) splice site probably benign
R1832:Dmxl2 UTSW 9 54,368,233 (GRCm39) missense probably damaging 0.97
R1922:Dmxl2 UTSW 9 54,308,807 (GRCm39) missense probably benign
R2104:Dmxl2 UTSW 9 54,322,848 (GRCm39) missense probably damaging 1.00
R2109:Dmxl2 UTSW 9 54,301,097 (GRCm39) missense probably benign 0.06
R2145:Dmxl2 UTSW 9 54,323,194 (GRCm39) missense probably damaging 1.00
R2199:Dmxl2 UTSW 9 54,283,527 (GRCm39) missense probably benign 0.35
R2352:Dmxl2 UTSW 9 54,301,146 (GRCm39) missense probably damaging 1.00
R2516:Dmxl2 UTSW 9 54,307,378 (GRCm39) missense probably damaging 1.00
R2981:Dmxl2 UTSW 9 54,300,986 (GRCm39) missense probably damaging 1.00
R3430:Dmxl2 UTSW 9 54,384,745 (GRCm39) missense possibly damaging 0.94
R3625:Dmxl2 UTSW 9 54,300,927 (GRCm39) missense probably benign 0.23
R3725:Dmxl2 UTSW 9 54,301,053 (GRCm39) missense probably damaging 1.00
R3787:Dmxl2 UTSW 9 54,277,162 (GRCm39) missense probably damaging 1.00
R4002:Dmxl2 UTSW 9 54,381,116 (GRCm39) splice site probably benign
R4004:Dmxl2 UTSW 9 54,353,674 (GRCm39) missense probably benign 0.04
R4005:Dmxl2 UTSW 9 54,353,674 (GRCm39) missense probably benign 0.04
R4012:Dmxl2 UTSW 9 54,286,297 (GRCm39) splice site probably null
R4014:Dmxl2 UTSW 9 54,285,993 (GRCm39) splice site probably null
R4115:Dmxl2 UTSW 9 54,354,272 (GRCm39) nonsense probably null
R4232:Dmxl2 UTSW 9 54,327,193 (GRCm39) missense possibly damaging 0.89
R4388:Dmxl2 UTSW 9 54,303,551 (GRCm39) missense probably damaging 1.00
R4513:Dmxl2 UTSW 9 54,327,168 (GRCm39) missense probably null 0.17
R4552:Dmxl2 UTSW 9 54,359,047 (GRCm39) missense probably damaging 1.00
R4609:Dmxl2 UTSW 9 54,353,796 (GRCm39) missense probably damaging 1.00
R4625:Dmxl2 UTSW 9 54,311,404 (GRCm39) missense possibly damaging 0.55
R4694:Dmxl2 UTSW 9 54,354,189 (GRCm39) missense probably benign 0.04
R4711:Dmxl2 UTSW 9 54,358,208 (GRCm39) missense probably benign 0.37
R4715:Dmxl2 UTSW 9 54,353,689 (GRCm39) splice site probably null
R4746:Dmxl2 UTSW 9 54,359,080 (GRCm39) missense probably benign 0.04
R4789:Dmxl2 UTSW 9 54,287,099 (GRCm39) missense probably benign 0.30
R4825:Dmxl2 UTSW 9 54,311,325 (GRCm39) missense probably benign 0.01
R4911:Dmxl2 UTSW 9 54,318,937 (GRCm39) missense probably damaging 1.00
R4995:Dmxl2 UTSW 9 54,408,725 (GRCm39) utr 5 prime probably benign
R5026:Dmxl2 UTSW 9 54,323,960 (GRCm39) missense probably damaging 1.00
R5118:Dmxl2 UTSW 9 54,368,271 (GRCm39) missense probably damaging 1.00
R5174:Dmxl2 UTSW 9 54,352,768 (GRCm39) splice site probably null
R5288:Dmxl2 UTSW 9 54,286,041 (GRCm39) missense probably benign
R5373:Dmxl2 UTSW 9 54,276,473 (GRCm39) intron probably benign
R5374:Dmxl2 UTSW 9 54,276,473 (GRCm39) intron probably benign
R5385:Dmxl2 UTSW 9 54,286,041 (GRCm39) missense probably benign
R5386:Dmxl2 UTSW 9 54,286,041 (GRCm39) missense probably benign
R5418:Dmxl2 UTSW 9 54,281,935 (GRCm39) critical splice donor site probably null
R5540:Dmxl2 UTSW 9 54,301,141 (GRCm39) missense probably benign 0.21
R5568:Dmxl2 UTSW 9 54,330,643 (GRCm39) splice site probably null
R5733:Dmxl2 UTSW 9 54,283,550 (GRCm39) missense possibly damaging 0.64
R5758:Dmxl2 UTSW 9 54,380,248 (GRCm39) missense probably benign 0.28
R5759:Dmxl2 UTSW 9 54,282,792 (GRCm39) missense probably damaging 1.00
R6030:Dmxl2 UTSW 9 54,300,957 (GRCm39) missense probably benign 0.18
R6030:Dmxl2 UTSW 9 54,300,957 (GRCm39) missense probably benign 0.18
R6041:Dmxl2 UTSW 9 54,324,037 (GRCm39) missense probably damaging 1.00
R6174:Dmxl2 UTSW 9 54,301,011 (GRCm39) missense probably damaging 1.00
R6278:Dmxl2 UTSW 9 54,323,046 (GRCm39) missense probably damaging 1.00
R6307:Dmxl2 UTSW 9 54,289,990 (GRCm39) missense possibly damaging 0.68
R6349:Dmxl2 UTSW 9 54,327,193 (GRCm39) missense possibly damaging 0.89
R6404:Dmxl2 UTSW 9 54,282,820 (GRCm39) missense probably damaging 1.00
R6516:Dmxl2 UTSW 9 54,323,960 (GRCm39) missense probably damaging 1.00
R6712:Dmxl2 UTSW 9 54,318,908 (GRCm39) missense probably damaging 1.00
R6747:Dmxl2 UTSW 9 54,323,372 (GRCm39) missense probably damaging 1.00
R6769:Dmxl2 UTSW 9 54,323,808 (GRCm39) missense probably damaging 1.00
R6771:Dmxl2 UTSW 9 54,323,808 (GRCm39) missense probably damaging 1.00
R6800:Dmxl2 UTSW 9 54,316,467 (GRCm39) missense probably damaging 1.00
R6891:Dmxl2 UTSW 9 54,387,664 (GRCm39) missense probably damaging 0.99
R6920:Dmxl2 UTSW 9 54,379,496 (GRCm39) missense probably damaging 1.00
R6979:Dmxl2 UTSW 9 54,358,163 (GRCm39) missense possibly damaging 0.49
R7147:Dmxl2 UTSW 9 54,324,013 (GRCm39) missense probably benign 0.06
R7327:Dmxl2 UTSW 9 54,308,869 (GRCm39) missense probably damaging 1.00
R7462:Dmxl2 UTSW 9 54,273,916 (GRCm39) splice site probably null
R7526:Dmxl2 UTSW 9 54,308,241 (GRCm39) missense possibly damaging 0.47
R7569:Dmxl2 UTSW 9 54,323,271 (GRCm39) missense possibly damaging 0.51
R7622:Dmxl2 UTSW 9 54,379,502 (GRCm39) missense probably damaging 0.99
R7638:Dmxl2 UTSW 9 54,365,078 (GRCm39) missense unknown
R7703:Dmxl2 UTSW 9 54,368,370 (GRCm39) missense probably benign 0.01
R7768:Dmxl2 UTSW 9 54,288,223 (GRCm39) missense probably damaging 1.00
R7926:Dmxl2 UTSW 9 54,335,326 (GRCm39) missense probably benign 0.01
R7969:Dmxl2 UTSW 9 54,354,165 (GRCm39) missense possibly damaging 0.85
R8007:Dmxl2 UTSW 9 54,290,975 (GRCm39) nonsense probably null
R8200:Dmxl2 UTSW 9 54,387,630 (GRCm39) missense probably benign
R8311:Dmxl2 UTSW 9 54,354,217 (GRCm39) missense probably benign 0.00
R8320:Dmxl2 UTSW 9 54,291,043 (GRCm39) missense probably benign
R8377:Dmxl2 UTSW 9 54,286,032 (GRCm39) missense probably damaging 1.00
R8400:Dmxl2 UTSW 9 54,291,037 (GRCm39) missense probably benign 0.03
R8509:Dmxl2 UTSW 9 54,335,341 (GRCm39) nonsense probably null
R8698:Dmxl2 UTSW 9 54,281,953 (GRCm39) missense probably benign 0.10
R8768:Dmxl2 UTSW 9 54,301,105 (GRCm39) missense possibly damaging 0.83
R8770:Dmxl2 UTSW 9 54,311,298 (GRCm39) missense probably benign 0.01
R8799:Dmxl2 UTSW 9 54,327,027 (GRCm39) critical splice donor site probably null
R8840:Dmxl2 UTSW 9 54,309,139 (GRCm39) missense possibly damaging 0.58
R8898:Dmxl2 UTSW 9 54,308,941 (GRCm39) missense probably benign 0.01
R8954:Dmxl2 UTSW 9 54,381,156 (GRCm39) missense probably benign 0.04
R9083:Dmxl2 UTSW 9 54,316,548 (GRCm39) missense probably benign 0.29
R9114:Dmxl2 UTSW 9 54,307,321 (GRCm39) missense
R9115:Dmxl2 UTSW 9 54,309,011 (GRCm39) missense probably benign
R9263:Dmxl2 UTSW 9 54,358,945 (GRCm39) missense probably benign 0.01
R9272:Dmxl2 UTSW 9 54,311,404 (GRCm39) missense possibly damaging 0.55
R9577:Dmxl2 UTSW 9 54,323,664 (GRCm39) missense unknown
R9673:Dmxl2 UTSW 9 54,294,840 (GRCm39) missense probably damaging 1.00
R9722:Dmxl2 UTSW 9 54,323,892 (GRCm39) missense probably benign 0.00
R9726:Dmxl2 UTSW 9 54,322,996 (GRCm39) missense probably benign 0.09
R9797:Dmxl2 UTSW 9 54,358,187 (GRCm39) missense probably benign 0.00
X0064:Dmxl2 UTSW 9 54,308,997 (GRCm39) missense probably benign
Z1177:Dmxl2 UTSW 9 54,289,318 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTGGTTTATACCTAAGTCCCAGAG -3'
(R):5'- AGAGCTTCCGTCCCATTCAG -3'

Sequencing Primer
(F):5'- CCTAAGTCCCAGAGGATTTTAATTTC -3'
(R):5'- ATTCAGCACCTCCTGTGGC -3'
Posted On 2017-02-15