Mutagenetix > Incidental Mutation

Incidental Mutation 'R5893:Vps13c'

457309

Institutional Source

Beutler Lab

Gene Symbol

Vps13c

Ensembl Gene

ENSMUSG00000035284

Gene Name

vacuolar protein sorting 13C

Synonyms

C230055H22Rik

MMRRC Submission

044094-MU

Accession Numbers

Genbank: NM_177184; MGI: 2444207

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5893 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

67840396-67995638 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to T at 67902839 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000077040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077879] [ENSMUST00000077879] [ENSMUST00000077879] [ENSMUST00000077879] [ENSMUST00000077879] [ENSMUST00000077879] [ENSMUST00000077879] [ENSMUST00000217386]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000077879

SMART Domains

Protein: ENSMUSP00000077040
Gene: ENSMUSG00000035284

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	3	117	1.3e-39	PFAM
low complexity region	151	165	N/A	INTRINSIC
Pfam:VPS13	182	414	7.9e-70	PFAM
coiled coil region	422	443	N/A	INTRINSIC
low complexity region	479	490	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	611	832	7.8e-71	PFAM
low complexity region	867	885	N/A	INTRINSIC
low complexity region	1020	1036	N/A	INTRINSIC
low complexity region	1112	1123	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	1172	1369	2.1e-14	PFAM
low complexity region	1552	1573	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	1685	1883	2.8e-13	PFAM
Blast:INB	2128	2403	2e-48	BLAST
Pfam:SHR-BD	2759	3013	9.9e-32	PFAM
Pfam:VPS13_C	3317	3495	5.7e-65	PFAM
Pfam:ATG_C	3498	3588	7.9e-12	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000077879

SMART Domains

Protein: ENSMUSP00000077040
Gene: ENSMUSG00000035284

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	3	117	1.3e-39	PFAM
low complexity region	151	165	N/A	INTRINSIC
Pfam:VPS13	182	414	7.9e-70	PFAM
coiled coil region	422	443	N/A	INTRINSIC
low complexity region	479	490	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	611	832	7.8e-71	PFAM
low complexity region	867	885	N/A	INTRINSIC
low complexity region	1020	1036	N/A	INTRINSIC
low complexity region	1112	1123	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	1172	1369	2.1e-14	PFAM
low complexity region	1552	1573	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	1685	1883	2.8e-13	PFAM
Blast:INB	2128	2403	2e-48	BLAST
Pfam:SHR-BD	2759	3013	9.9e-32	PFAM
Pfam:VPS13_C	3317	3495	5.7e-65	PFAM
Pfam:ATG_C	3498	3588	7.9e-12	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000077879

SMART Domains

Protein: ENSMUSP00000077040
Gene: ENSMUSG00000035284

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	3	117	1.3e-39	PFAM
low complexity region	151	165	N/A	INTRINSIC
Pfam:VPS13	182	414	7.9e-70	PFAM
coiled coil region	422	443	N/A	INTRINSIC
low complexity region	479	490	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	611	832	7.8e-71	PFAM
low complexity region	867	885	N/A	INTRINSIC
low complexity region	1020	1036	N/A	INTRINSIC
low complexity region	1112	1123	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	1172	1369	2.1e-14	PFAM
low complexity region	1552	1573	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	1685	1883	2.8e-13	PFAM
Blast:INB	2128	2403	2e-48	BLAST
Pfam:SHR-BD	2759	3013	9.9e-32	PFAM
Pfam:VPS13_C	3317	3495	5.7e-65	PFAM
Pfam:ATG_C	3498	3588	7.9e-12	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000077879

SMART Domains

Protein: ENSMUSP00000077040
Gene: ENSMUSG00000035284

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	3	117	1.3e-39	PFAM
low complexity region	151	165	N/A	INTRINSIC
Pfam:VPS13	182	414	7.9e-70	PFAM
coiled coil region	422	443	N/A	INTRINSIC
low complexity region	479	490	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	611	832	7.8e-71	PFAM
low complexity region	867	885	N/A	INTRINSIC
low complexity region	1020	1036	N/A	INTRINSIC
low complexity region	1112	1123	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	1172	1369	2.1e-14	PFAM
low complexity region	1552	1573	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	1685	1883	2.8e-13	PFAM
Blast:INB	2128	2403	2e-48	BLAST
Pfam:SHR-BD	2759	3013	9.9e-32	PFAM
Pfam:VPS13_C	3317	3495	5.7e-65	PFAM
Pfam:ATG_C	3498	3588	7.9e-12	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000077879

SMART Domains

Protein: ENSMUSP00000077040
Gene: ENSMUSG00000035284

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	3	117	1.3e-39	PFAM
low complexity region	151	165	N/A	INTRINSIC
Pfam:VPS13	182	414	7.9e-70	PFAM
coiled coil region	422	443	N/A	INTRINSIC
low complexity region	479	490	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	611	832	7.8e-71	PFAM
low complexity region	867	885	N/A	INTRINSIC
low complexity region	1020	1036	N/A	INTRINSIC
low complexity region	1112	1123	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	1172	1369	2.1e-14	PFAM
low complexity region	1552	1573	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	1685	1883	2.8e-13	PFAM
Blast:INB	2128	2403	2e-48	BLAST
Pfam:SHR-BD	2759	3013	9.9e-32	PFAM
Pfam:VPS13_C	3317	3495	5.7e-65	PFAM
Pfam:ATG_C	3498	3588	7.9e-12	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000077879

SMART Domains

Protein: ENSMUSP00000077040
Gene: ENSMUSG00000035284

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	3	117	1.3e-39	PFAM
low complexity region	151	165	N/A	INTRINSIC
Pfam:VPS13	182	414	7.9e-70	PFAM
coiled coil region	422	443	N/A	INTRINSIC
low complexity region	479	490	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	611	832	7.8e-71	PFAM
low complexity region	867	885	N/A	INTRINSIC
low complexity region	1020	1036	N/A	INTRINSIC
low complexity region	1112	1123	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	1172	1369	2.1e-14	PFAM
low complexity region	1552	1573	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	1685	1883	2.8e-13	PFAM
Blast:INB	2128	2403	2e-48	BLAST
Pfam:SHR-BD	2759	3013	9.9e-32	PFAM
Pfam:VPS13_C	3317	3495	5.7e-65	PFAM
Pfam:ATG_C	3498	3588	7.9e-12	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000077879

SMART Domains

Protein: ENSMUSP00000077040
Gene: ENSMUSG00000035284

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	3	117	1.3e-39	PFAM
low complexity region	151	165	N/A	INTRINSIC
Pfam:VPS13	182	414	7.9e-70	PFAM
coiled coil region	422	443	N/A	INTRINSIC
low complexity region	479	490	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	611	832	7.8e-71	PFAM
low complexity region	867	885	N/A	INTRINSIC
low complexity region	1020	1036	N/A	INTRINSIC
low complexity region	1112	1123	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	1172	1369	2.1e-14	PFAM
low complexity region	1552	1573	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	1685	1883	2.8e-13	PFAM
Blast:INB	2128	2403	2e-48	BLAST
Pfam:SHR-BD	2759	3013	9.9e-32	PFAM
Pfam:VPS13_C	3317	3495	5.7e-65	PFAM
Pfam:ATG_C	3498	3588	7.9e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000217386

Meta Mutation Damage Score

0.9486

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

95% (73/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vacuolar protein sorting-associated 13 gene family. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]

Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	T	A	19: 57,215,853	R35S	probably benign	Het
Acacb	A	T	5: 114,229,851	I1637F	probably benign	Het
Adamts18	A	T	8: 113,773,077	C402S	probably damaging	Het
Adra2b	T	A	2: 127,364,482	D306E	probably benign	Het
Ammecr1l	C	T	18: 31,778,920	T263I	probably damaging	Het
Antxr1	T	C	6: 87,137,259	I509V	probably benign	Het
Bahcc1	A	G	11: 120,285,430	E1967G	probably damaging	Het
Brap	T	A	5: 121,679,342	Y337*	probably null	Het
Brca2	T	C	5: 150,569,138	V3206A	probably benign	Het
C330027C09Rik	A	G	16: 48,997,500	S78G	probably benign	Het
Cacna1e	A	T	1: 154,437,323	F1486I	probably damaging	Het
Cbx4	A	G	11: 119,082,190	Y120H	probably damaging	Het
Ccar2	T	A	14: 70,151,351	Q137L	probably benign	Het
Ceacam12	A	G	7: 18,069,374	D235G	probably damaging	Het
Celsr1	A	G	15: 85,904,014	V2679A	probably benign	Het
Champ1	C	T	8: 13,878,777	P312S	probably benign	Het
Chst5	A	G	8: 111,890,196	L264S	probably damaging	Het
Colec10	T	A	15: 54,410,789	F4L	probably benign	Het
Cyp2a4	G	A	7: 26,308,928	G165D	probably damaging	Het
Cyp2c29	G	C	19: 39,330,389	A438P	possibly damaging	Het
Dlat	A	G	9: 50,644,139		probably benign	Het
Dmxl2	A	G	9: 54,387,420	V2457A	possibly damaging	Het
Dnah7a	A	G	1: 53,457,785	M3104T	possibly damaging	Het
Dock8	C	T	19: 25,122,447	H645Y	probably damaging	Het
Ehbp1l1	T	C	19: 5,718,431	E948G	probably benign	Het
Eps8l2	C	T	7: 141,357,624	R384C	probably damaging	Het
Fam174a	A	T	1: 95,325,159	N162I	probably damaging	Het
Fbp2	T	A	13: 62,837,102	N335I	probably benign	Het
Foxred2	C	A	15: 77,947,144	G490C	probably damaging	Het
Fyttd1	T	G	16: 32,898,913	D200E	probably damaging	Het
Gdf15	A	T	8: 70,629,823	V211E	possibly damaging	Het
Gm13084	T	A	4: 143,810,468	Y431F	probably damaging	Het
Gm13178	C	T	4: 144,703,196	V408I	probably benign	Het
Gm5065	A	T	7: 5,359,624	T85S	probably benign	Het
Gm6214	A	G	3: 140,839,346		noncoding transcript	Het
Havcr2	A	G	11: 46,456,316	Y40C	probably damaging	Het
Htra1	T	G	7: 130,961,591	V184G	probably damaging	Het
Hydin	A	T	8: 110,490,676	I1399F	probably benign	Het
Igtp	T	C	11: 58,206,648	L215P	probably damaging	Het
Kctd1	T	C	18: 14,969,688	E812G	possibly damaging	Het
Lap3	T	C	5: 45,511,279		probably benign	Het
Lrp1b	C	A	2: 40,601,587	A223S	probably damaging	Het
Mtnr1b	A	T	9: 15,863,244	V173E	probably damaging	Het
Nat10	A	C	2: 103,721,839		probably benign	Het
Ndfip2	T	A	14: 105,294,857	V229E	probably damaging	Het
Nefh	G	A	11: 4,941,323	T432M	probably damaging	Het
Nfe2l3	A	G	6: 51,457,852	Y464C	probably damaging	Het
Nrip1	C	A	16: 76,293,953	A239S	probably damaging	Het
Olfml2b	A	G	1: 170,662,473	S221G	probably benign	Het
Orc4	G	T	2: 48,905,547	S389*	probably null	Het
P4hb	A	G	11: 120,571,650	S77P	probably damaging	Het
Pcyt2	T	C	11: 120,617,797		probably null	Het
Plagl1	T	C	10: 13,128,194		probably benign	Het
Poglut1	C	T	16: 38,529,595	R272Q	probably damaging	Het
Rdh5	T	C	10: 128,914,221		probably null	Het
Rogdi	A	T	16: 5,013,394	L3*	probably null	Het
Skap1	T	C	11: 96,581,398	*166Q	probably null	Het
Slc38a4	A	G	15: 96,999,551	I461T	probably benign	Het
Snx31	A	C	15: 36,523,455	I360M	probably damaging	Het
Spata22	A	T	11: 73,336,247	K96*	probably null	Het
Strn3	A	T	12: 51,643,223		probably null	Het
Trip12	A	C	1: 84,759,163		probably benign	Het
Uggt1	A	T	1: 36,227,628		probably null	Het
Upk3a	A	C	15: 85,019,337	D79A	probably damaging	Het
Uts2r	A	T	11: 121,161,279	Y323F	probably benign	Het
Vmn2r1	A	T	3: 64,086,553	N107Y	probably damaging	Het
Wnt7b	A	G	15: 85,581,374		probably benign	Het
Zfp410	T	A	12: 84,337,611		probably null	Het

Other mutations in Vps13c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Vps13c	APN	9	67945999	missense	probably benign	0.20
IGL00336:Vps13c	APN	9	67945942	missense	probably benign	0.01
IGL00418:Vps13c	APN	9	67876262	missense	probably damaging	1.00
IGL00481:Vps13c	APN	9	67860865	missense	probably damaging	1.00
IGL00491:Vps13c	APN	9	67893136	missense	probably damaging	1.00
IGL00558:Vps13c	APN	9	67937857	missense	possibly damaging	0.52
IGL00811:Vps13c	APN	9	67948181	missense	probably damaging	0.99
IGL01011:Vps13c	APN	9	67926955	missense	probably damaging	0.98
IGL01094:Vps13c	APN	9	67886284	missense	probably damaging	1.00
IGL01330:Vps13c	APN	9	67964108	missense	probably damaging	1.00
IGL01402:Vps13c	APN	9	67913204	critical splice acceptor site	probably null
IGL01404:Vps13c	APN	9	67913204	critical splice acceptor site	probably null
IGL01470:Vps13c	APN	9	67912927	splice site	probably benign
IGL01615:Vps13c	APN	9	67955781	missense	probably benign	0.01
IGL01694:Vps13c	APN	9	67895349	missense	probably damaging	1.00
IGL01752:Vps13c	APN	9	67948228	missense	probably damaging	1.00
IGL01810:Vps13c	APN	9	67955780	missense	probably benign
IGL01954:Vps13c	APN	9	67969298	missense	probably damaging	0.98
IGL01978:Vps13c	APN	9	67930643	missense	probably benign	0.03
IGL01998:Vps13c	APN	9	67955068	splice site	probably null
IGL02201:Vps13c	APN	9	67967136	missense	probably damaging	1.00
IGL02205:Vps13c	APN	9	67883454	missense	probably damaging	1.00
IGL02303:Vps13c	APN	9	67945481	splice site	probably benign
IGL02322:Vps13c	APN	9	67937901	missense	probably benign	0.02
IGL02456:Vps13c	APN	9	67952976	missense	probably damaging	1.00
IGL02474:Vps13c	APN	9	67937876	missense	probably benign	0.00
IGL02547:Vps13c	APN	9	67908019	missense	possibly damaging	0.83
IGL02640:Vps13c	APN	9	67886248	splice site	probably benign
IGL02673:Vps13c	APN	9	67878098	missense	probably damaging	1.00
IGL02721:Vps13c	APN	9	67964149	splice site	probably benign
IGL02834:Vps13c	APN	9	67937855	missense	probably benign
IGL02838:Vps13c	APN	9	67975851	missense	probably damaging	1.00
IGL03136:Vps13c	APN	9	67950310	missense	probably damaging	1.00
IGL03137:Vps13c	APN	9	67890380	missense	probably damaging	1.00
IGL03214:Vps13c	APN	9	67897195	missense	probably null	0.81
IGL03240:Vps13c	APN	9	67955047	missense	probably benign
IGL03303:Vps13c	APN	9	67934504	missense	probably benign	0.27
IGL03336:Vps13c	APN	9	67951642	missense	possibly damaging	0.76
IGL03366:Vps13c	APN	9	67946026	missense	probably benign	0.00
Derivative	UTSW	9	67930622	missense	possibly damaging	0.79
diversion	UTSW	9	67910233	missense	possibly damaging	0.93
introversion	UTSW	9	67944046	missense	probably damaging	0.98
Inversion	UTSW	9	67902839	critical splice acceptor site	probably null
subversion	UTSW	9	67908052	missense	probably damaging	1.00
Transversion	UTSW	9	67934501	missense	probably damaging	0.98
3-1:Vps13c	UTSW	9	67936373	missense	probably benign	0.00
IGL02991:Vps13c	UTSW	9	67913877	missense	probably damaging	1.00
PIT4802001:Vps13c	UTSW	9	67937786	missense	probably damaging	1.00
R0008:Vps13c	UTSW	9	67919262	missense	probably benign
R0206:Vps13c	UTSW	9	67939162	splice site	probably benign
R0288:Vps13c	UTSW	9	67927366	missense	probably damaging	0.99
R0324:Vps13c	UTSW	9	67964309	missense	possibly damaging	0.95
R0347:Vps13c	UTSW	9	67910233	missense	possibly damaging	0.93
R0374:Vps13c	UTSW	9	67886246	splice site	probably benign
R0388:Vps13c	UTSW	9	67922915	splice site	probably benign
R0409:Vps13c	UTSW	9	67951644	missense	probably benign	0.00
R0440:Vps13c	UTSW	9	67972861	missense	probably damaging	1.00
R0513:Vps13c	UTSW	9	67930735	missense	probably benign	0.02
R0520:Vps13c	UTSW	9	67945851	missense	possibly damaging	0.88
R0569:Vps13c	UTSW	9	67973719	missense	probably damaging	0.98
R0601:Vps13c	UTSW	9	67927472	missense	probably benign	0.12
R0659:Vps13c	UTSW	9	67920935	missense	probably benign	0.11
R0667:Vps13c	UTSW	9	67951573	nonsense	probably null
R0670:Vps13c	UTSW	9	67925857	missense	probably benign	0.35
R0698:Vps13c	UTSW	9	67889723	missense	probably benign	0.45
R0729:Vps13c	UTSW	9	67961649	missense	probably damaging	1.00
R0781:Vps13c	UTSW	9	67972003	missense	probably damaging	1.00
R0811:Vps13c	UTSW	9	67934476	missense	probably benign	0.06
R0812:Vps13c	UTSW	9	67934476	missense	probably benign	0.06
R0839:Vps13c	UTSW	9	67898738	missense	probably benign
R1373:Vps13c	UTSW	9	67927511	missense	probably damaging	0.99
R1396:Vps13c	UTSW	9	67955022	missense	probably benign	0.00
R1499:Vps13c	UTSW	9	67957505	missense	probably benign	0.00
R1556:Vps13c	UTSW	9	67930711	missense	probably damaging	0.98
R1560:Vps13c	UTSW	9	67936463	critical splice donor site	probably null
R1584:Vps13c	UTSW	9	67893112	missense	possibly damaging	0.74
R1654:Vps13c	UTSW	9	67951687	missense	probably damaging	1.00
R1674:Vps13c	UTSW	9	67853703	nonsense	probably null
R1676:Vps13c	UTSW	9	67926962	missense	probably benign	0.20
R1695:Vps13c	UTSW	9	67972075	nonsense	probably null
R1710:Vps13c	UTSW	9	67911529	missense	probably benign	0.00
R1769:Vps13c	UTSW	9	67965721	missense	probably benign	0.00
R1775:Vps13c	UTSW	9	67881447	missense	probably damaging	1.00
R1795:Vps13c	UTSW	9	67893985	nonsense	probably null
R1799:Vps13c	UTSW	9	67944117	missense	probably damaging	0.98
R1835:Vps13c	UTSW	9	67993013	missense	probably benign	0.08
R1848:Vps13c	UTSW	9	67936340	missense	probably benign
R1903:Vps13c	UTSW	9	67894052	missense	probably damaging	1.00
R1944:Vps13c	UTSW	9	67886276	missense	probably damaging	1.00
R1945:Vps13c	UTSW	9	67886276	missense	probably damaging	1.00
R1951:Vps13c	UTSW	9	67973759	critical splice donor site	probably null
R1993:Vps13c	UTSW	9	67975856	missense	probably damaging	1.00
R2023:Vps13c	UTSW	9	67936285	splice site	probably benign
R2059:Vps13c	UTSW	9	67860833	missense	probably damaging	1.00
R2086:Vps13c	UTSW	9	67950289	missense	probably benign	0.29
R2120:Vps13c	UTSW	9	67919334	missense	possibly damaging	0.92
R2249:Vps13c	UTSW	9	67988053	critical splice donor site	probably null
R2257:Vps13c	UTSW	9	67952946	missense	possibly damaging	0.87
R2258:Vps13c	UTSW	9	67953860	missense	probably benign	0.01
R2259:Vps13c	UTSW	9	67953860	missense	probably benign	0.01
R2260:Vps13c	UTSW	9	67953860	missense	probably benign	0.01
R2265:Vps13c	UTSW	9	67920947	missense	possibly damaging	0.82
R2266:Vps13c	UTSW	9	67920947	missense	possibly damaging	0.82
R2269:Vps13c	UTSW	9	67920947	missense	possibly damaging	0.82
R2278:Vps13c	UTSW	9	67939072	missense	probably benign
R2306:Vps13c	UTSW	9	67987993	missense	probably damaging	0.99
R2327:Vps13c	UTSW	9	67913820	missense	probably damaging	0.98
R2349:Vps13c	UTSW	9	67957526	missense	possibly damaging	0.89
R2483:Vps13c	UTSW	9	67975907	critical splice donor site	probably null
R3031:Vps13c	UTSW	9	67923770	missense	probably benign	0.00
R3623:Vps13c	UTSW	9	67975907	critical splice donor site	probably null
R3870:Vps13c	UTSW	9	67884726	missense	probably benign	0.00
R4173:Vps13c	UTSW	9	67936313	missense	probably benign	0.00
R4445:Vps13c	UTSW	9	67982495	splice site	probably null
R4491:Vps13c	UTSW	9	67910193	missense	probably benign
R4505:Vps13c	UTSW	9	67939034	missense	probably benign	0.02
R4574:Vps13c	UTSW	9	67951683	missense	probably damaging	1.00
R4691:Vps13c	UTSW	9	67952935	missense	possibly damaging	0.95
R4766:Vps13c	UTSW	9	67878224	splice site	probably null
R4771:Vps13c	UTSW	9	67929539	missense	probably benign
R4801:Vps13c	UTSW	9	67964282	missense	probably damaging	1.00
R4802:Vps13c	UTSW	9	67964282	missense	probably damaging	1.00
R4962:Vps13c	UTSW	9	67873891	missense	probably damaging	1.00
R4995:Vps13c	UTSW	9	67919321	missense	probably benign	0.00
R5010:Vps13c	UTSW	9	67916379	missense	probably benign	0.19
R5183:Vps13c	UTSW	9	67908052	missense	probably damaging	1.00
R5226:Vps13c	UTSW	9	67945553	missense	probably benign	0.17
R5297:Vps13c	UTSW	9	67878131	missense	probably damaging	1.00
R5456:Vps13c	UTSW	9	67927447	missense	possibly damaging	0.53
R5494:Vps13c	UTSW	9	67948146	missense	probably benign	0.00
R5521:Vps13c	UTSW	9	67951439	missense	probably benign	0.08
R5524:Vps13c	UTSW	9	67957556	missense	probably damaging	1.00
R5685:Vps13c	UTSW	9	67963173	missense	possibly damaging	0.64
R5731:Vps13c	UTSW	9	67895379	missense	probably damaging	1.00
R5812:Vps13c	UTSW	9	67982495	splice site	probably benign
R5867:Vps13c	UTSW	9	67982622	splice site	probably null
R5902:Vps13c	UTSW	9	67934447	missense	probably benign	0.00
R5957:Vps13c	UTSW	9	67954971	missense	probably damaging	1.00
R6076:Vps13c	UTSW	9	67911602	missense	probably damaging	1.00
R6187:Vps13c	UTSW	9	67915657	missense	probably damaging	1.00
R6268:Vps13c	UTSW	9	67951449	missense	probably benign	0.10
R6547:Vps13c	UTSW	9	67973365	missense	probably damaging	1.00
R6716:Vps13c	UTSW	9	67951467	missense	probably benign	0.00
R6837:Vps13c	UTSW	9	67910222	missense	probably benign
R6919:Vps13c	UTSW	9	67927452	missense	probably damaging	0.97
R7039:Vps13c	UTSW	9	67937763	missense	probably damaging	1.00
R7058:Vps13c	UTSW	9	67923828	missense	probably benign	0.39
R7082:Vps13c	UTSW	9	67883453	missense	probably damaging	1.00
R7195:Vps13c	UTSW	9	67945825	missense	possibly damaging	0.95
R7244:Vps13c	UTSW	9	67889804	missense	probably benign	0.00
R7300:Vps13c	UTSW	9	67940544	missense	probably benign	0.20
R7314:Vps13c	UTSW	9	67943340	splice site	probably null
R7352:Vps13c	UTSW	9	67840446	missense	possibly damaging	0.94
R7368:Vps13c	UTSW	9	67914073	missense	probably benign	0.23
R7411:Vps13c	UTSW	9	67972001	missense	probably damaging	0.98
R7497:Vps13c	UTSW	9	67840479	missense	probably damaging	1.00
R7516:Vps13c	UTSW	9	67955007	missense	possibly damaging	0.89
R7638:Vps13c	UTSW	9	67945509	missense	probably damaging	1.00
R7732:Vps13c	UTSW	9	67940516	missense	probably damaging	0.97
R7748:Vps13c	UTSW	9	67963089	missense	probably benign	0.03
R7779:Vps13c	UTSW	9	67881422	missense	probably damaging	1.00
R7788:Vps13c	UTSW	9	67940483	missense	probably benign	0.01
R7894:Vps13c	UTSW	9	67926983	missense	probably damaging	0.99
R8163:Vps13c	UTSW	9	67950438	missense	probably benign	0.08
R8165:Vps13c	UTSW	9	67858790	missense	probably benign	0.00
R8202:Vps13c	UTSW	9	67944046	missense	probably damaging	0.98
R8235:Vps13c	UTSW	9	67927396	missense	probably damaging	1.00
R8235:Vps13c	UTSW	9	67955781	missense	probably benign	0.01
R8253:Vps13c	UTSW	9	67943488	nonsense	probably null
R8261:Vps13c	UTSW	9	67954980	missense	probably damaging	1.00
R8348:Vps13c	UTSW	9	67879103	missense	possibly damaging	0.79
R8547:Vps13c	UTSW	9	67945566	missense	probably damaging	1.00
R8734:Vps13c	UTSW	9	67973403	missense	probably damaging	1.00
R8806:Vps13c	UTSW	9	67945828	missense	probably damaging	1.00
R8807:Vps13c	UTSW	9	67858840	missense	probably damaging	0.99
R8813:Vps13c	UTSW	9	67871284	missense	probably damaging	1.00
R8883:Vps13c	UTSW	9	67948197	missense	probably benign	0.10
R8885:Vps13c	UTSW	9	67943454	missense	probably benign
R8899:Vps13c	UTSW	9	67934501	missense	probably damaging	0.98
R8970:Vps13c	UTSW	9	67945521	missense	probably benign	0.11
R9007:Vps13c	UTSW	9	67937724	missense	probably benign	0.00
R9026:Vps13c	UTSW	9	67954581	missense	probably damaging	1.00
R9029:Vps13c	UTSW	9	67948147	missense	probably damaging	0.98
R9057:Vps13c	UTSW	9	67920927	missense	probably benign	0.00
R9105:Vps13c	UTSW	9	67870799	intron	probably benign
R9130:Vps13c	UTSW	9	67929523	missense	probably damaging	1.00
R9286:Vps13c	UTSW	9	67972921	missense	probably benign	0.00
R9338:Vps13c	UTSW	9	67951695	missense	probably damaging	1.00
R9432:Vps13c	UTSW	9	67922855	missense	probably benign	0.02
R9460:Vps13c	UTSW	9	67930622	missense	possibly damaging	0.79
R9464:Vps13c	UTSW	9	67951392	missense	probably damaging	1.00
R9561:Vps13c	UTSW	9	67965512	missense	probably damaging	1.00
R9609:Vps13c	UTSW	9	67934549	missense	probably damaging	1.00
R9622:Vps13c	UTSW	9	67949433	missense	probably damaging	1.00
R9665:Vps13c	UTSW	9	67955743	nonsense	probably null
R9731:Vps13c	UTSW	9	67919244	missense	probably benign
R9763:Vps13c	UTSW	9	67911578	missense	probably benign	0.00
R9774:Vps13c	UTSW	9	67884591	missense	possibly damaging	0.85
R9798:Vps13c	UTSW	9	67919364	missense	probably damaging	1.00
U24488:Vps13c	UTSW	9	67905916	missense	probably benign	0.13
X0021:Vps13c	UTSW	9	67937781	missense	probably damaging	0.99
X0058:Vps13c	UTSW	9	67927419	missense	probably damaging	1.00
X0065:Vps13c	UTSW	9	67873863	missense	probably damaging	1.00
Z1088:Vps13c	UTSW	9	67913975	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAATACTGTGTAGGCTCCGGC -3'
(R):5'- AATGCCCTGAAGTCAGTGTTGG -3'

Sequencing Primer
(F):5'- TAGGCTCCGGCTGACTGTTAC -3'
(R):5'- TTGGCAGCACAGATAAGAGACTCC -3'

Posted On

2017-02-15